Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-22 precursor URS00003A4D14_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-22: Bta-mir-22 is a microRNA that has been identified as a potential regulator of tenderness and is involved in calcium signaling in the heart [PMC6182065]. It targets the mitochondrial L-carnitine shuttle pathway and glutathione reductase (GSR) [PMC6182065]. Bta-mir-22 also targets genes involved in calcium signaling, such as the calcium channel, voltage-dependent, N type, alpha 1B subunit (CACNA1B) and ATPase, calcium-transporting, plasma membrane 2 (ATP2B2) [PMC6182065]. It also targets genes from the Calpain family, including calpain 1 (CAPN1) and calpain 11 (CAPN11), as well as calpastatin (CAST) [PMC6182065]. Bta-mir-22 has been found to be differentially expressed in bovine macrophages in response to M. bovis expression [PMC4978967]. The 3p arm of bta-mir-22 precursor is functionally more relevant than the corresponding 5p arm during the late follicular phase of preovulatory stage of bovine estrous cycle [PMC4438052]. Bta-mir-22 has also been identified as miR-22* [PMC2762473].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Ailuropoda melanoleuca mir-22
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-22 precursor
  3. Capra hircus microRNA mir-22 (ENSCHIG00000009214.1)
  4. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000019768.2)
  5. Cercocebus atys miRNA (ENSCATG00000008898.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000005919.1)
  7. Dasypus novemcinctus (nine-banded armadillo) microRNA 22 (ENSDNOG00000028846.1)
  8. Equus caballus microRNA eca-mir-22 precursor
  9. Gorilla gorilla gorilla microRNA 22 (ENSGGOG00000029560.2)
  10. Homo sapiens (human) microRNA hsa-mir-22 precursor
  11. Lagothrix lagotricha microRNA lla-mir-22 precursor
  12. Lemur catta microRNA lca-mir-22 precursor
  13. Macaca mulatta (Rhesus monkey) microRNA mml-mir-22 precursor
  14. Macaca nemestrina microRNA mne-mir-22 precursor
  15. Mandrillus leucophaeus miRNA (ENSMLEG00000003004.1)
  16. Marmota monax (woodchuck) non-coding RNA
  17. Microcebus murinus microRNA 22 (ENSMICG00000019565.3)
  18. Mustela putorius furo (Domestic ferret) microRNA 22 (ENSMPUG00000020709.1)
  19. Myotis lucifugus microRNA 22 (ENSMLUG00000017946.1)
  20. Neogale vison microRNA 22 (ENSNVIG00000010566.1)
  21. Nomascus leucogenys microRNA 22 (ENSNLEG00000022919.2)
  22. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017367.1)
  23. Ovis aries microRNA oar-mir-22 precursor
  24. Pan paniscus microRNA ppa-mir-22 precursor
  25. Panthera pardus (leopard) microRNA 22 (ENSPPRG00000014363.1)
  26. Panthera tigris altaica miRNA (ENSPTIG00000001915.1)
  27. Pan troglodytes (chimpanzee) microRNA ptr-mir-22 precursor
  28. Pongo abelii miRNA
  29. Pongo pygmaeus microRNA ppy-mir-22 precursor
  30. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000009993.1)
  31. Rhinopithecus roxellana miRNA (ENSRROG00000027294.1)
Publications