Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ailuropoda melanoleuca (giant panda) mir-22 URS00003A4D14_9646

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGAGCCGCAGUAGUUCUUCAGUGGCAAGCUUUAUGUCCUGACCCAGCUAAAGCUGCCAGUUGAAGAACUGUUGCCCUCUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 43 other species

  1. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-22 precursor
  2. Bos taurus microRNA bta-mir-22 precursor
  3. Capra hircus microRNA mir-22 (ENSCHIG00000009214.1)
  4. Carlito syrichta (Philippine tarsier) miRNA (ENSTSYG00000019768.2)
  5. Cercocebus atys miRNA (ENSCATG00000008898.1)
  6. Colobus angolensis palliatus miRNA (ENSCANG00000005919.1)
  7. Dasypus novemcinctus (nine-banded armadillo) microRNA 22 (ENSDNOG00000028846.1)
  8. Equus caballus microRNA eca-mir-22 precursor
  9. Gorilla gorilla gorilla microRNA 22 (ENSGGOG00000029560.2)
  10. Homo sapiens (human) microRNA hsa-mir-22 precursor
  11. Lagothrix lagotricha microRNA lla-mir-22 precursor
  12. Lemur catta microRNA lca-mir-22 precursor
  13. Macaca mulatta (Rhesus monkey) microRNA mml-mir-22 precursor
  14. Macaca nemestrina microRNA mne-mir-22 precursor
  15. Mandrillus leucophaeus miRNA (ENSMLEG00000003004.1)
  16. Marmota monax (woodchuck) non-coding RNA
  17. Microcebus murinus microRNA 22 (ENSMICG00000019565.3)
  18. Mustela putorius furo (Domestic ferret) microRNA 22 (ENSMPUG00000020709.1)
  19. Myotis lucifugus microRNA 22 (ENSMLUG00000017946.1)
  20. Neogale vison microRNA 22 (ENSNVIG00000010566.1)
  21. Nomascus leucogenys microRNA 22 (ENSNLEG00000022919.2)
  22. Otolemur garnettii (small-eared galago) miRNA (ENSOGAG00000017367.1)
  23. Ovis aries microRNA oar-mir-22 precursor
  24. Pan paniscus microRNA ppa-mir-22 precursor
  25. Panthera pardus (leopard) microRNA 22 (ENSPPRG00000014363.1)
  26. Panthera tigris altaica miRNA (ENSPTIG00000001915.1)
  27. Pan troglodytes (chimpanzee) microRNA ptr-mir-22 precursor
  28. Pongo abelii miRNA
  29. Pongo pygmaeus microRNA ppy-mir-22 precursor
  30. Rhinopithecus bieti (Black snub-nosed monkey) miRNA (ENSRBIG00000009993.1)
  31. Rhinopithecus roxellana miRNA (ENSRROG00000027294.1)