Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Myotis davidii tRNA secondary structure diagram

Myotis davidii tRNA URS00003A4B65_225400

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCAGUGGCCUAAUGGAUAAGGCAUUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCAUCUGGGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 95 other species

  1. Ailuropoda melanoleuca tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  2. Alligator mississippiensis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  3. Amazona aestiva tRNA
  4. Anolis carolinensis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  5. Aptenodytes forsteri (emperor penguin) tRNA
  6. Balaenoptera acutorostrata scammoni tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  7. Bos taurus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  8. Callipepla squamata (scaled quail) tRNA
  9. Callithrix jacchus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  10. Calypte anna tRNA
  11. Camelus ferus tRNA
  12. Canis lupus familiaris tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  13. Carlito syrichta tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  14. Cavia porcellus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  15. Ceratotherium simum simum tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  16. Chelonia mydas (green seaturtle) tRNA
  17. Chelydra serpentina tRNA-Arg
  18. Chlorocebus sabaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  19. Choloepus hoffmanni tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  20. Chrysemys picta bellii tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  21. Colinus virginianus tRNA
  22. Colius striatus (speckled mousebird) tRNA
  23. Columba livia partial tRNA-Arg
  24. Cricetulus griseus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  25. Cuculus canorus (common cuckoo) tRNA
  26. Dasypus novemcinctus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  27. Dipodomys ordii tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  28. Echinops telfairi tRNA-Arg (CCT) (tRNA-Arg-CCT-6-1)
  29. Eptesicus nilssonii tRNA-Arg
  30. Equus caballus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  31. Erinaceus europaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  32. Felis catus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  33. Ficedula albicollis tRNA
  34. Fukomys damarensis tRNA
  35. Gallus gallus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  36. Geospiza fortis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  37. Gorilla gorilla gorilla tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  38. Heterocephalus glaber tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  39. Homo sapiens tRNA-Arg (anticodon CCT) 4-1 (TRR-CCT4-1)
  40. Ictidomys tridecemlineatus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  41. Lamprotornis superbus tRNA-OTHER
  42. Latimeria chalumnae tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  43. Lepisosteus oculatus (spotted gar) tRNA
  44. Loxodonta africana tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  45. Macaca mulatta tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  46. Marmota monax (woodchuck) tRNA.Arg
  47. Meleagris gallopavo tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  48. Melopsittacus undulatus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  49. Mesocricetus auratus tRNA
  50. Microcebus murinus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  51. Monodelphis domestica tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  52. Mus caroli tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  53. Mus musculus castaneus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  54. Mus musculus domesticus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  55. Mus musculus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  56. Mus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  57. Mus pahari tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  58. Mus spretus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  59. Mustela putorius furo tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  60. Myotis brandtii tRNA
  61. Myotis lucifugus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  62. Nipponia nippon tRNA
  63. Nomascus leucogenys tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  64. Notamacropus eugenii tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  65. Ochotona princeps tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  66. Ophiophagus hannah (king cobra) tRNA
  67. Oryctolagus cuniculus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  68. Otolemur garnettii tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  69. Ovis aries tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  70. Pangasianodon gigas (Mekong giant catfish) tRNA-Arg
  71. Pangasianodon hypophthalmus tRNA-Arg
  72. Pangasius djambal tRNA-Arg
  73. Pan troglodytes tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  74. Papio anubis tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  75. Patagioenas fasciata monilis tRNA
  76. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  77. Dryobates pubescens tRNA
  78. Podarcis lilfordi tRNA.Arg
  79. Pongo abelii tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  80. Procavia capensis tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  81. Pteropus alecto tRNA
  82. Rattus norvegicus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  83. Saimiri boliviensis boliviensis tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  84. Sarcophilus harrisii tRNA
  85. Scleropages formosus tRNA
  86. Sorex araneus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  87. Sphaerodactylus townsendi tRNA-Arg
  88. Struthio camelus australis tRNA
  89. Sus scrofa tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  90. Taeniopygia guttata tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  91. Tinamus guttatus tRNA
  92. Trichechus manatus latirostris tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  93. Tupaia chinensis tRNA
  94. Tursiops truncatus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  95. Vicugna pacos tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
2D structure Publications