Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cavia porcellus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1) secondary structure diagram

Cavia porcellus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1) URS00003A4B65_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCCAGUGGCCUAAUGGAUAAGGCAUUGGCCUCCUAAGCCAGGGAUUGUGGGUUCGAGUCCCAUCUGGGGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 95 other species

  1. Ailuropoda melanoleuca tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  2. Alligator mississippiensis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  3. Amazona aestiva tRNA
  4. Anolis carolinensis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  5. Aptenodytes forsteri (emperor penguin) tRNA
  6. Balaenoptera acutorostrata scammoni tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  7. Bos taurus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  8. Callipepla squamata (scaled quail) tRNA
  9. Callithrix jacchus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  10. Calypte anna tRNA
  11. Camelus ferus tRNA
  12. Canis lupus familiaris tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  13. Carlito syrichta tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  14. Ceratotherium simum simum tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  15. Chelonia mydas (green seaturtle) tRNA
  16. Chelydra serpentina tRNA-Arg
  17. Chlorocebus sabaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  18. Choloepus hoffmanni tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  19. Chrysemys picta bellii tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  20. Colinus virginianus tRNA
  21. Colius striatus (speckled mousebird) tRNA
  22. Columba livia partial tRNA-Arg
  23. Cricetulus griseus tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  24. Cuculus canorus (common cuckoo) tRNA
  25. Dasypus novemcinctus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  26. Dipodomys ordii tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  27. Echinops telfairi tRNA-Arg (CCT) (tRNA-Arg-CCT-6-1)
  28. Eptesicus nilssonii tRNA-Arg
  29. Equus caballus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  30. Erinaceus europaeus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  31. Felis catus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  32. Ficedula albicollis tRNA
  33. Fukomys damarensis tRNA
  34. Gallus gallus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  35. Geospiza fortis tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  36. Gorilla gorilla gorilla tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  37. Heterocephalus glaber tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  38. Homo sapiens tRNA-Arg (anticodon CCT) 4-1 (TRR-CCT4-1)
  39. Ictidomys tridecemlineatus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  40. Lamprotornis superbus tRNA-OTHER
  41. Latimeria chalumnae tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  42. Lepisosteus oculatus (spotted gar) tRNA
  43. Loxodonta africana tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  44. Macaca mulatta tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  45. Marmota monax (woodchuck) tRNA.Arg
  46. Meleagris gallopavo tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  47. Melopsittacus undulatus tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  48. Mesocricetus auratus tRNA
  49. Microcebus murinus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  50. Monodelphis domestica tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  51. Mus caroli tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  52. Mus musculus castaneus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  53. Mus musculus domesticus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  54. Mus musculus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  55. Mus musculus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  56. Mus pahari tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  57. Mus spretus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  58. Mustela putorius furo tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  59. Myotis brandtii tRNA
  60. Myotis davidii tRNA
  61. Myotis lucifugus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  62. Nipponia nippon tRNA
  63. Nomascus leucogenys tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  64. Notamacropus eugenii tRNA-Arg (CCT) (tRNA-Arg-CCT-1-1)
  65. Ochotona princeps tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  66. Ophiophagus hannah (king cobra) tRNA
  67. Oryctolagus cuniculus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  68. Otolemur garnettii tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  69. Ovis aries tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  70. Pangasianodon gigas (Mekong giant catfish) tRNA-Arg
  71. Pangasianodon hypophthalmus tRNA-Arg
  72. Pangasius djambal tRNA-Arg
  73. Pan troglodytes tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  74. Papio anubis tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  75. Patagioenas fasciata monilis tRNA
  76. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  77. Dryobates pubescens tRNA
  78. Podarcis lilfordi tRNA.Arg
  79. Pongo abelii tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  80. Procavia capensis tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  81. Pteropus alecto tRNA
  82. Rattus norvegicus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  83. Saimiri boliviensis boliviensis tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  84. Sarcophilus harrisii tRNA
  85. Scleropages formosus tRNA
  86. Sorex araneus tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  87. Sphaerodactylus townsendi tRNA-Arg
  88. Struthio camelus australis tRNA
  89. Sus scrofa tRNA-Arg (CCT) (tRNA-Arg-CCT-4-1)
  90. Taeniopygia guttata tRNA-Arg (CCT) (tRNA-Arg-CCT-2-1)
  91. Tinamus guttatus tRNA
  92. Trichechus manatus latirostris tRNA-Arg (CCT) (tRNA-Arg-CCT-3-1)
  93. Tupaia chinensis tRNA
  94. Tursiops truncatus tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
  95. Vicugna pacos tRNA-Arg (CCT) (tRNA-Arg-CCT-5-1)
2D structure Publications