Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Dasypus novemcinctus (nine-banded armadillo) dno-miR-363-3p URS000038B599_9361

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUUGCACGGUAUCCAUCUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Alligator mississippiensis Ami-Mir-92-P2c_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-92-P2c_3p (mature (guide))
  3. Callithrix jacchus cja-miR-363
  4. Callorhinchus milii (elephant shark) Cmi-Mir-92-P2c_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-92-P2c_3p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-363-3p
  7. Cervus elaphus cel-miR-363-3p
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-92-P2c_3p (mature (guide))
  9. Columba livia (rock pigeon) Cli-Mir-92-P2c_3p (mature (guide))
  10. Cyprinus carpio (common carp) ccr-miR-363
  11. Danio rerio (zebrafish) dre-miR-363-3p
  12. Equus caballus eca-miR-363
  13. Gallus gallus Gga-Mir-92-P2c_3p (mature (guide))
  14. Gekko japonicus Gja-Mir-92-P2c_3p (mature (guide))
  15. Homo sapiens hsa-miR-363-3p
  16. Latimeria chalumnae (coelacanth) Lch-Mir-92-P2c_3p (mature (guide))
  17. Lepisosteus oculatus (spotted gar) Loc-Mir-92-P2c_3p (mature (guide))
  18. Macaca mulatta (Rhesus monkey) mml-miR-363-3p
  19. Microcaecilia unicolor Mun-Mir-92-P2c_3p (mature (guide))
  20. Monodelphis domestica Mdo-Mir-92-P2c_3p (mature (guide))
  21. Mus musculus mmu-miR-363-3p
  22. Ornithorhynchus anatinus (platypus) Oan-Mir-92-P2c_3p (mature (guide))
  23. Oryctolagus cuniculus (rabbit) ocu-miR-363-3p
  24. Pongo pygmaeus (Bornean orangutan) ppy-miR-363
  25. Pteropus alecto (black flying fox) pal-miR-363-3p
  26. Python bivittatus Pbv-Mir-92-P2c_3p (mature (guide))
  27. Rattus norvegicus Rno-Mir-92-P2c_3p (mature (guide))
  28. Sarcophilus harrisii Sha-Mir-92-P2c_3p (mature (guide))
  29. Scyliorhinus torazame Sto-Mir-92-P2c_3p (mature (guide))
  30. Sphenodon punctatus Spt-Mir-92-P2c_3p (mature (guide))
  31. Taeniopygia guttata (zebra finch) Tgu-Mir-92-P2c_3p (mature (guide))
  32. Tor tambroides (Thai mahseer) miR-363-3p
  33. Tupaia chinensis (Chinese tree shrew) tch-miR-363-3p
  34. Xenopus laevis xla-miR-363-3p
  35. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-92-P2c_3p (mature (guide))