Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-363-3p URS000038B599_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-363: Mmu-mir-363 is a microRNA that targets the 3'-UTR of p300 mRNA and is associated with increased expression of mmu-miR-451 [PMC4114167]. Mmu-miR-451 is known to destabilize cytokine mRNAs [PMC4114167]. Tumors with retroviral integration sites within the mmu-mir-106a-363 locus showed higher expression of the primary mmu-mir-106a-363 transcript, as well as mature mmu-miR-106a and mmu-mir-363, compared to tumors with other integration sites [PMC7290785]. These tumors also exhibited increased expression levels of mmu-mir-106a and mmu-mir-363 compared to tumors without integrations in this region [PMC1794537]. The mature species of mmu-mir-106a and mmu-mir-363 were measured using qPCR in tumors with integrations in this region, and a statistically significant difference in expression was observed compared to tumor controls [PMC1794537]. The amplification efficiencies of the calibration curves for mmu-mir-106a and mmu-mir-363 were 67% and 69%, respectively [PMC1794537]. The retroviral integrations in this region also affected the expression of the mir-106a cistron, as measured by qPCR for primary transcript levels (Kis2) and mature miRNA levels (mmu-miR -106a and -363) [PMC1794537]. Overexpression of EST AI464896, which maps to the same location as mmu -mir -363, was observed in tumors with proviral MLV integrations into this region [PMC1794537]. These findings suggest that retroviral integrations within this locus can impact the expression levels of mir-106a and mir-363 [PMC1794537].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUUGCACGGUAUCCAUCUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 35 other species

  1. Alligator mississippiensis Ami-Mir-92-P2c_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-92-P2c_3p (mature (guide))
  3. Callithrix jacchus cja-miR-363
  4. Callorhinchus milii (elephant shark) Cmi-Mir-92-P2c_3p (mature (guide))
  5. Canis lupus familiaris Cfa-Mir-92-P2c_3p (mature (guide))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-363-3p
  7. Cervus elaphus cel-miR-363-3p
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-92-P2c_3p (mature (guide))
  9. Columba livia (rock pigeon) Cli-Mir-92-P2c_3p (mature (guide))
  10. Cyprinus carpio (common carp) ccr-miR-363
  11. Danio rerio (zebrafish) dre-miR-363-3p
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-363-3p
  13. Equus caballus eca-miR-363
  14. Gallus gallus Gga-Mir-92-P2c_3p (mature (guide))
  15. Gekko japonicus Gja-Mir-92-P2c_3p (mature (guide))
  16. Homo sapiens hsa-miR-363-3p
  17. Latimeria chalumnae (coelacanth) Lch-Mir-92-P2c_3p (mature (guide))
  18. Lepisosteus oculatus (spotted gar) Loc-Mir-92-P2c_3p (mature (guide))
  19. Macaca mulatta (Rhesus monkey) mml-miR-363-3p
  20. Microcaecilia unicolor Mun-Mir-92-P2c_3p (mature (guide))
  21. Monodelphis domestica Mdo-Mir-92-P2c_3p (mature (guide))
  22. Ornithorhynchus anatinus (platypus) Oan-Mir-92-P2c_3p (mature (guide))
  23. Oryctolagus cuniculus (rabbit) ocu-miR-363-3p
  24. Pongo pygmaeus (Bornean orangutan) ppy-miR-363
  25. Pteropus alecto (black flying fox) pal-miR-363-3p
  26. Python bivittatus Pbv-Mir-92-P2c_3p (mature (guide))
  27. Rattus norvegicus Rno-Mir-92-P2c_3p (mature (guide))
  28. Sarcophilus harrisii Sha-Mir-92-P2c_3p (mature (guide))
  29. Scyliorhinus torazame Sto-Mir-92-P2c_3p (mature (guide))
  30. Sphenodon punctatus Spt-Mir-92-P2c_3p (mature (guide))
  31. Taeniopygia guttata (zebra finch) Tgu-Mir-92-P2c_3p (mature (guide))
  32. Tor tambroides (Thai mahseer) miR-363-3p
  33. Tupaia chinensis (Chinese tree shrew) tch-miR-363-3p
  34. Xenopus laevis xla-miR-363-3p
  35. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-92-P2c_3p (mature (guide))
Publications