Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Ala (GCN) (MT-TA) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Ala (GCN) (MT-TA) URS000036D40A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TA: MT-TA is a gene located in the mitochondrial genome, specifically in the region from nucleotide 5303 to 5803 in the revised Cambridge Reference Sequence (rCRS) [PMC1564046]. This gene, along with MT-ND2, MT-TW, and MT-NC3, is outputted from this region [PMC1564046]. The alleles of MT-TA, MT-TC, and MT-TT have been found to potentially enhance the generation of reactive oxygen species (ROS), which is a critical contributor to gouty attacks [PMC6034246]. The cycling program for a specific mutation (m.5628 T > C) in the MT-TA region involves specific temperature stages for PCR amplification [PMC6034246]. Similarly, for another mutation (m.9957 T > C) in the MT-CO3 region, specific amplification protocols are followed [PMC6034246]. The allelic discrimination plots generated from these amplification protocols are analyzed using StepOnePlus SW v2.3 software [PMC6034246]. References: - PMC1564046 - PMC6034246

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGGCUUAGCUUAAUUAAAGUGGCUGAUUUGCGUUCAGUUGAUGCAGAGUGGGGUUUUGCAGUCCUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cloning vector pRS316-1B9 tRNA-Ala
  2. Homo sapiens neanderthalensis transfer RNA-Ala
  3. Homo sapiens subsp. 'Denisova' tRNA-Ala
  4. Pan paniscus (bonobo) mitochondrially encoded tRNA-Ala (GCN) (ENSPPAG00000000012.1)
  5. Pan troglodytes mitochondrially encoded tRNA-Ala (GCN) (ENSPTRG00000042642.1)
  6. Pan troglodytes ellioti tRNA-Ala
  7. Pan troglodytes schweinfurthii tRNA-Ala
  8. Pan troglodytes troglodytes tRNA-Ala
  9. Pan troglodytes ellioti tRNA-Ala
  10. Pan troglodytes verus tRNA-Ala
2D structure Publications