Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes (chimpanzee) mitochondrially encoded tRNA-Ala (GCN) (ENSPTRG00000042642.1) secondary structure diagram

Pan troglodytes (chimpanzee) mitochondrially encoded tRNA-Ala (GCN) (ENSPTRG00000042642.1) URS000036D40A_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGGCUUAGCUUAAUUAAAGUGGCUGAUUUGCGUUCAGUUGAUGCAGAGUGGGGUUUUGCAGUCCUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cloning vector pRS316-1B9 tRNA-Ala
  2. Homo sapiens (human) mitochondrially encoded tRNA-Ala (GCN) (MT-TA)
  3. Homo sapiens neanderthalensis transfer RNA-Ala
  4. Homo sapiens subsp. 'Denisova' tRNA-Ala
  5. Pan paniscus (bonobo) mitochondrially encoded tRNA-Ala (GCN) (ENSPPAG00000000012.1)
  6. Pan troglodytes ellioti tRNA-Ala
  7. Pan troglodytes schweinfurthii tRNA-Ala
  8. Pan troglodytes troglodytes tRNA-Ala
  9. Pan troglodytes ellioti tRNA-Ala
  10. Pan troglodytes verus tRNA-Ala
2D structure Publications