Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-143-5p URS0000365CE3_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-143: Ssc-mir-143 is a microRNA that has been found to have increased expression in E. coli F18-sensitive pigs [PMC3427155]. It is one of 12 miRNAs that showed differential expression in pigs susceptible to E. coli F18 infection [PMC3427155]. Ssc-mir-143 has the highest level of expression in the intestinal tract and is believed to be related to a rapid growth phase in weaned piglets [PMC3427155]. It has also been associated with fat metabolism and fat cell differentiation in mammals [PMC3427155]. Ssc-mir-143 is highly expressed in pig backfat tissue and represents 20% of the total miRNA expression [PMC3901342]. In addition, ssc-mir-143 has been found to be regulated by three different transcription factors and may play a role in muscle fiber regulation through the HDAC4-MEF2 pathway [PMC3427155] [PMC4410957]. Abundant miRNAs, including ssc-mir-143, have also been found to have higher editing probability [PMC6677090]. Overall, ssc-mir-143 appears to be involved in various biological processes and may serve as a potential disease marker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGCAGUGCUGCAUCUCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-miR-143-5p
  2. Anolis carolinensis aca-miR-143-5p
  3. Capra hircus (goat) chi-miR-143-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-143-5p
  5. Cervus elaphus (red deer) cel-miR-143-5p
  6. Chiloscyllium plagiosum microRNA cpl-miR-143-5p
  7. Chrysemys picta (Painted turtle) cpi-miR-143-5p
  8. Columba livia (rock pigeon) cli-miR-143-5p
  9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-143-5p
  10. Gallus gallus (chicken) gga-miR-143-5p
  11. Mus musculus mmu-miR-143-5p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-143-5p
  13. Rattus norvegicus (Norway rat) rno-miR-143-5p
  14. Xenopus laevis (African clawed frog) xla-miR-143*
Publications