Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Columba livia (rock pigeon) cli-miR-143-5p URS0000365CE3_8932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUGCAGUGCUGCAUCUCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Alligator mississippiensis (American alligator) ami-miR-143-5p
  2. Anolis carolinensis aca-miR-143-5p
  3. Capra hircus (goat) chi-miR-143-5p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-143-5p
  5. Cervus elaphus (red deer) cel-miR-143-5p
  6. Chiloscyllium plagiosum microRNA cpl-miR-143-5p
  7. Chrysemys picta (Painted turtle) cpi-miR-143-5p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-143-5p
  9. Gallus gallus (chicken) gga-miR-143-5p
  10. Mus musculus mmu-miR-143-5p
  11. Oryctolagus cuniculus (rabbit) ocu-miR-143-5p
  12. Rattus norvegicus (Norway rat) rno-miR-143-5p
  13. Sus scrofa (pig) ssc-miR-143-5p
  14. Xenopus laevis (African clawed frog) xla-miR-143*