v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes troglodytes tRNA-Glu secondary structure diagram

Pan troglodytes troglodytes tRNA-Glu URS000034E9D0_37011

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUUCUUGUAGUUGAAAUACAACGAUGGUUUUUCAUAUCAUUGGUCGUGGUUGUAGUCCGUGCGAGAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cloning vector pRS316-1B9 tRNA-Glu
  2. Homo heidelbergensis tRNA-Glu
  3. Homo sapiens mitochondrially encoded tRNA-Glu (GAA/G) (MT-TE)
  4. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Glu
  5. Pan paniscus mitochondrially encoded tRNA-Glu (GAA/G) (ENSPPAG00000000034.1)
  6. Pan troglodytes mitochondrially encoded tRNA-Glu (GAA/G) (ENSPTRG00000042625.1)
  7. Pan troglodytes ellioti tRNA-Glu
  8. Pan troglodytes schweinfurthii tRNA-Glu
  9. Pan troglodytes ellioti tRNA-Glu
  10. Pan troglodytes verus tRNA-Glu
 2D structure