Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Cloning vector pRS316-1B9 tRNA-Glu secondary structure diagram

Cloning vector pRS316-1B9 tRNA-Glu URS000034E9D0_1054602

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCUUGUAGUUGAAAUACAACGAUGGUUUUUCAUAUCAUUGGUCGUGGUUGUAGUCCGUGCGAGAAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Homo heidelbergensis tRNA-Glu
  2. Homo sapiens mitochondrially encoded tRNA-Glu (GAA/G) (MT-TE)
  3. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Glu
  4. Pan paniscus mitochondrially encoded tRNA-Glu (GAA/G) (ENSPPAG00000000034.1)
  5. Pan troglodytes mitochondrially encoded tRNA-Glu (GAA/G) (ENSPTRG00000042625.1)
  6. Pan troglodytes ellioti tRNA-Glu
  7. Pan troglodytes schweinfurthii tRNA-Glu
  8. Pan troglodytes troglodytes tRNA-Glu
  9. Pan troglodytes ellioti tRNA-Glu
  10. Pan troglodytes verus tRNA-Glu
2D structure