v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pteropus alecto (black flying fox) tRNA secondary structure diagram

Pteropus alecto (black flying fox) tRNA URS000034AAC2_9402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGUUGGUGGUAUAGUGGUGAGCAUAGCUGCCUUCCAAGCAGUUGACCCGGGUUCGAUUCCCGGCCAACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 150 other species

  1. Acanthisitta chloris tRNA
  2. Acropora cervicornis tRNA-Gly
  3. Acropora millepora tRNA-Gly
  4. Ailuropoda melanoleuca tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  5. Albula goreensis tRNA-Gly
  6. Alligator mississippiensis tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-3-2)
  7. Alligator sinensis tRNA
  8. Alosa alosa tRNA-Gly
  9. Amazona aestiva tRNA
  10. Ameiurus melas tRNA-Gly
  11. Anas platyrhynchos tRNA
  12. Anguilla anguilla (European eel) tRNA-Gly
  13. Anolis carolinensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  14. Apaloderma vittatum tRNA
  15. Aptenodytes forsteri tRNA
  16. Astyanax mexicanus tRNA
  17. Balaenoptera acutorostrata scammoni tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  18. Balearica regulorum gibbericeps tRNA
  19. Bos taurus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 8)
  20. Buceros rhinoceros silvestris tRNA
  21. Callipepla squamata tRNA
  22. Callithrix jacchus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  23. Calypte anna tRNA
  24. Camelus ferus (Wild Bactrian camel) tRNA
  25. Canis lupus familiaris tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  26. Antrostomus carolinensis tRNA
  27. Cariama cristata tRNA
  28. Carlito syrichta tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  29. Cathartes aura tRNA
  30. Cavia porcellus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  31. Ceratotherium simum simum tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  32. Chaetura pelagica tRNA
  33. Charadrius vociferus tRNA
  34. Chelonia mydas tRNA
  35. Chlamydotis macqueenii tRNA
  36. Chlorocebus sabaeus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  37. Choloepus hoffmanni tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  38. Colinus virginianus tRNA
  39. Colius striatus tRNA
  40. Columba livia tRNA
  41. Cricetulus griseus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  42. Cuculus canorus tRNA
  43. Dallia pectoralis tRNA-Gly
  44. Danionella translucida tRNA-Gly
  45. Danio rerio tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 19)
  46. Dasypus novemcinctus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  47. Dipodomys ordii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 9)
  48. Echinops telfairi tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  49. Egretta garzetta tRNA
  50. Eptesicus nilssonii tRNA-Gly
  51. Equus caballus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  52. Erinaceus europaeus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  53. Eurypyga helias tRNA
  54. Felis catus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  55. Ficedula albicollis tRNA
  56. Fukomys damarensis tRNA
  57. Fulmarus glacialis (northern fulmar) tRNA
  58. Gadus morhua tRNA-Gly (TCC) (tRNA-Gly-TCC-4 1 to 3)
  59. Gallus gallus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  60. Gasterosteus aculeatus tRNA
  61. Gavia stellata tRNA
  62. Geospiza fortis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  63. Gorilla gorilla gorilla tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  64. Haliaeetus albicilla tRNA
  65. Heterocephalus glaber tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  66. Hippoglossus stenolepis tRNA-Gly
  67. Homo sapiens tRNA-Gly (anticodon TCC) 2-1 (TRG-TCC2 1 to 6)
  68. Ictidomys tridecemlineatus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  69. Lamprotornis superbus tRNA-OTHER
  70. Lepisosteus oculatus tRNA
  71. Leptosomus discolor tRNA
  72. Lonchura striata domestica tRNA
  73. Loxodonta africana tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  74. Macaca mulatta tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  75. Manacus vitellinus tRNA
  76. Marmota monax (woodchuck) tRNA.Gly
  77. Meleagris gallopavo tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 10)
  78. Melopsittacus undulatus tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  79. Merluccius polli tRNA-Gly
  80. Merops nubicus tRNA
  81. Mesitornis unicolor (brown roatelo) tRNA
  82. Mesocricetus auratus tRNA
  83. Microcebus murinus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  84. Monodelphis domestica tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  85. Mus caroli tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  86. Mus musculus castaneus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  87. Mus musculus domesticus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  88. Mus musculus musculus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  89. Mus musculus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  90. Mus pahari tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  91. Mus spretus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  92. Mustela putorius furo tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  93. Myotis brandtii tRNA
  94. Myotis davidii tRNA
  95. Myotis lucifugus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  96. Nematostella vectensis tRNA-Gly for anticodon UCC
  97. Neotoma lepida tRNA
  98. Nestor notabilis tRNA
  99. Nipponia nippon tRNA
  100. Nomascus leucogenys tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  101. Notamacropus eugenii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  102. Ochotona princeps tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  103. Ophiophagus hannah tRNA
  104. Opisthocomus hoazin tRNA
  105. Ornithorhynchus anatinus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  106. Oryctolagus cuniculus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 13)
  107. Otolemur garnettii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  108. Ovis aries tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  109. Pangasianodon gigas (Mekong giant catfish) tRNA-Gly
  110. Pangasianodon hypophthalmus tRNA-Gly
  111. Pangasius djambal tRNA-Gly
  112. Pan troglodytes tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  113. Papio anubis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  114. Patagioenas fasciata monilis tRNA
  115. Pelecanus crispus tRNA
  116. Pelobates cultripes tRNA.Gly
  117. Perca flavescens (yellow perch) tRNA-Gly
  118. Perca fluviatilis tRNA-Gly
  119. Petromyzon marinus tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1)
  120. Phalacrocorax carbo tRNA
  121. Phoenicopterus ruber ruber tRNA
  122. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  123. Dryobates pubescens tRNA
  124. Pleuronectes platessa (European plaice) tRNA-Gly
  125. Pocillopora damicornis (Cauliflower coral) tRNA-Gly
  126. Podarcis lilfordi tRNA.Gly
  127. Podiceps cristatus (great crested grebe) tRNA
  128. Pongo abelii tRNA-Gly (TCC) (tRNA-Gly-TCC-2 2 to 4)
  129. Procavia capensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  130. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  131. Pygoscelis adeliae (Adelie penguin) tRNA
  132. Rattus norvegicus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 11, tRNA-Gly-TCC-3-1)
  133. Saimiri boliviensis boliviensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-3-2)
  134. Salmo salar tRNA
  135. Sarcophilus harrisii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  136. Serratia marcescens tRNA-Gly
  137. Sorex araneus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  138. Sphaerodactylus townsendi tRNA-Gly
  139. Struthio camelus australis tRNA
  140. Stylophora pistillata tRNA-Gly
  141. Sus scrofa tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 10)
  142. Taeniopygia guttata tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  143. Tauraco erythrolophus tRNA
  144. Tinamus guttatus tRNA
  145. Trichechus manatus latirostris tRNA-Gly (TCC) (tRNA-Gly-TCC-5-1, tRNA-Gly-TCC-5-2)
  146. Tupaia chinensis tRNA
  147. Tursiops truncatus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  148. Vicugna pacos tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  149. Xenopus laevis (African clawed frog) tRNA
  150. Xenopus tropicalis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 45)
 2D structure Publications