Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Amazona aestiva (blue-fronted amazon) tRNA secondary structure diagram

Amazona aestiva (blue-fronted amazon) tRNA URS000034AAC2_12930

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGUUGGUGGUAUAGUGGUGAGCAUAGCUGCCUUCCAAGCAGUUGACCCGGGUUCGAUUCCCGGCCAACGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 150 other species

  1. Acanthisitta chloris tRNA
  2. Acropora cervicornis tRNA-Gly
  3. Acropora millepora tRNA-Gly
  4. Ailuropoda melanoleuca tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  5. Albula goreensis tRNA-Gly
  6. Alligator mississippiensis tRNA-Gly (TCC) (tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-3-2)
  7. Alligator sinensis tRNA
  8. Alosa alosa tRNA-Gly
  9. Ameiurus melas tRNA-Gly
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla (European eel) tRNA-Gly
  12. Anolis carolinensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  13. Apaloderma vittatum tRNA
  14. Aptenodytes forsteri tRNA
  15. Astyanax mexicanus tRNA
  16. Balaenoptera acutorostrata scammoni tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  17. Balearica regulorum gibbericeps tRNA
  18. Bos taurus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 8)
  19. Buceros rhinoceros silvestris tRNA
  20. Callipepla squamata tRNA
  21. Callithrix jacchus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  22. Calypte anna tRNA
  23. Camelus ferus (Wild Bactrian camel) tRNA
  24. Canis lupus familiaris tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  25. Antrostomus carolinensis tRNA
  26. Cariama cristata tRNA
  27. Carlito syrichta tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  28. Cathartes aura tRNA
  29. Cavia porcellus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  30. Ceratotherium simum simum tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  31. Chaetura pelagica tRNA
  32. Charadrius vociferus tRNA
  33. Chelonia mydas tRNA
  34. Chlamydotis macqueenii tRNA
  35. Chlorocebus sabaeus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  36. Choloepus hoffmanni tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  37. Colinus virginianus tRNA
  38. Colius striatus tRNA
  39. Columba livia tRNA
  40. Cricetulus griseus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  41. Cuculus canorus tRNA
  42. Dallia pectoralis tRNA-Gly
  43. Danionella translucida tRNA-Gly
  44. Danio rerio tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 19)
  45. Dasypus novemcinctus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  46. Dipodomys ordii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 9)
  47. Echinops telfairi tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  48. Egretta garzetta tRNA
  49. Eptesicus nilssonii tRNA-Gly
  50. Equus caballus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  51. Erinaceus europaeus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  52. Eurypyga helias tRNA
  53. Felis catus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  54. Ficedula albicollis tRNA
  55. Fukomys damarensis tRNA
  56. Fulmarus glacialis (northern fulmar) tRNA
  57. Gadus morhua tRNA-Gly (TCC) (tRNA-Gly-TCC-4 1 to 3)
  58. Gallus gallus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  59. Gasterosteus aculeatus tRNA
  60. Gavia stellata tRNA
  61. Geospiza fortis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  62. Gorilla gorilla gorilla tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  63. Haliaeetus albicilla tRNA
  64. Heterocephalus glaber tRNA-Gly (TCC) (tRNA-Gly-TCC-2-1, tRNA-Gly-TCC-2-2)
  65. Hippoglossus stenolepis tRNA-Gly
  66. Homo sapiens tRNA-Gly (anticodon TCC) 2-1 (TRG-TCC2 1 to 6)
  67. Ictidomys tridecemlineatus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  68. Lamprotornis superbus tRNA-OTHER
  69. Lepisosteus oculatus tRNA
  70. Leptosomus discolor tRNA
  71. Lonchura striata domestica tRNA
  72. Loxodonta africana tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  73. Macaca mulatta tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  74. Manacus vitellinus tRNA
  75. Marmota monax (woodchuck) tRNA.Gly
  76. Meleagris gallopavo tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 10)
  77. Melopsittacus undulatus tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-1-2)
  78. Merluccius polli tRNA-Gly
  79. Merops nubicus tRNA
  80. Mesitornis unicolor (brown roatelo) tRNA
  81. Mesocricetus auratus tRNA
  82. Microcebus murinus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  83. Monodelphis domestica tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 3)
  84. Mus caroli tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  85. Mus musculus castaneus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  86. Mus musculus domesticus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  87. Mus musculus musculus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  88. Mus musculus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  89. Mus pahari tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  90. Mus spretus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  91. Mustela putorius furo tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  92. Myotis brandtii tRNA
  93. Myotis davidii tRNA
  94. Myotis lucifugus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  95. Nematostella vectensis tRNA-Gly for anticodon UCC
  96. Neotoma lepida tRNA
  97. Nestor notabilis tRNA
  98. Nipponia nippon tRNA
  99. Nomascus leucogenys tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  100. Notamacropus eugenii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  101. Ochotona princeps tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  102. Ophiophagus hannah tRNA
  103. Opisthocomus hoazin tRNA
  104. Ornithorhynchus anatinus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  105. Oryctolagus cuniculus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 13)
  106. Otolemur garnettii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  107. Ovis aries tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 6)
  108. Pangasianodon gigas (Mekong giant catfish) tRNA-Gly
  109. Pangasianodon hypophthalmus tRNA-Gly
  110. Pangasius djambal tRNA-Gly
  111. Pan troglodytes tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  112. Papio anubis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  113. Patagioenas fasciata monilis tRNA
  114. Pelecanus crispus tRNA
  115. Pelobates cultripes tRNA.Gly
  116. Perca flavescens (yellow perch) tRNA-Gly
  117. Perca fluviatilis tRNA-Gly
  118. Petromyzon marinus tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1)
  119. Phalacrocorax carbo tRNA
  120. Phoenicopterus ruber ruber tRNA
  121. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  122. Dryobates pubescens tRNA
  123. Pleuronectes platessa (European plaice) tRNA-Gly
  124. Pocillopora damicornis (Cauliflower coral) tRNA-Gly
  125. Podarcis lilfordi tRNA.Gly
  126. Podiceps cristatus (great crested grebe) tRNA
  127. Pongo abelii tRNA-Gly (TCC) (tRNA-Gly-TCC-2 2 to 4)
  128. Procavia capensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  129. Pterocles gutturalis (yellow-throated sandgrouse) tRNA
  130. Pteropus alecto tRNA
  131. Pygoscelis adeliae (Adelie penguin) tRNA
  132. Rattus norvegicus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 11, tRNA-Gly-TCC-3-1)
  133. Saimiri boliviensis boliviensis tRNA-Gly (TCC) (tRNA-Gly-TCC-1-1, tRNA-Gly-TCC-3-1, tRNA-Gly-TCC-3-2)
  134. Salmo salar tRNA
  135. Sarcophilus harrisii tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 7)
  136. Serratia marcescens tRNA-Gly
  137. Sorex araneus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  138. Sphaerodactylus townsendi tRNA-Gly
  139. Struthio camelus australis tRNA
  140. Stylophora pistillata tRNA-Gly
  141. Sus scrofa tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 10)
  142. Taeniopygia guttata tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 5)
  143. Tauraco erythrolophus tRNA
  144. Tinamus guttatus tRNA
  145. Trichechus manatus latirostris tRNA-Gly (TCC) (tRNA-Gly-TCC-5-1, tRNA-Gly-TCC-5-2)
  146. Tupaia chinensis tRNA
  147. Tursiops truncatus tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 3)
  148. Vicugna pacos tRNA-Gly (TCC) (tRNA-Gly-TCC-1 1 to 4)
  149. Xenopus laevis (African clawed frog) tRNA
  150. Xenopus tropicalis tRNA-Gly (TCC) (tRNA-Gly-TCC-2 1 to 45)
2D structure Publications