v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Tyr (anticodon GTA) 5-1 (TRY-GTA5 1 to 5) secondary structure diagram

Homo sapiens (human) tRNA-Tyr (anticodon GTA) 5-1 (TRY-GTA5 1 to 5) URS0000333F2E_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUUCGAUAGCUCAGCUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAUUCCGGCUCGAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 80 other species

  1. Ailuropoda melanoleuca tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  2. Alligator mississippiensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  3. Anniella stebbinsi tRNA-Tyr
  4. Anolis carolinensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 4)
  5. Balaenoptera acutorostrata scammoni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 5)
  6. Bos taurus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 7)
  7. Callithrix jacchus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 4)
  8. Callorhinchus milii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  9. Canis lupus familiaris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 3)
  10. Carlito syrichta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 3)
  11. Cavia porcellus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  12. Ceratotherium simum simum tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  13. Chlorocebus sabaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  14. Choloepus hoffmanni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4-1, tRNA-Tyr-GTA-4-2)
  15. Chrysemys picta bellii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  16. Cnephaeus nilssonii tRNA-Tyr
  17. Columba livia partial tRNA-Tyr
  18. Cricetulus griseus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  19. Dasypus novemcinctus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 5)
  20. Daubentonia madagascariensis tRNA-Tyr
  21. Dipodomys ordii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  22. Echinops telfairi tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  23. Cnephaeus nilssonii tRNA-Tyr
  24. Equus caballus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 9)
  25. Erinaceus europaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  26. Felis catus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 10)
  27. Gallus gallus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  28. Geospiza fortis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  29. Gorilla gorilla gorilla tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  30. Haplochromis burtoni tRNA-Tyr
  31. Heterocephalus glaber tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4-1, tRNA-Tyr-GTA-4-2)
  32. Ictidomys tridecemlineatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  33. Inia geoffrensis tRNA-Tyr
  34. Lamprotornis superbus tRNA-OTHER
  35. Latimeria chalumnae tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  36. Loxodonta africana tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 11)
  37. Lycocorax pyrrhopterus obiensis tRNA-Tyr
  38. Macaca mulatta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2, tRNA-Tyr-GTA-3 4 to 7)
  39. Meleagris gallopavo tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  40. Melopsittacus undulatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  41. Microcebus murinus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  42. Mimus melanotis tRNA-Tyr
  43. Monodelphis domestica tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  44. Mus caroli tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  45. Mus musculus castaneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1)
  46. Mus musculus domesticus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  47. Mus musculus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  48. Mus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  49. Mus pahari tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4-1, tRNA-Tyr-GTA-4-2)
  50. Mus spretus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  51. Mustela putorius furo tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  52. Myotis lucifugus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  53. Nomascus leucogenys tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 3)
  54. Notamacropus eugenii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  55. Ochotona princeps tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 5)
  56. Oreochromis niloticus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-5-1)
  57. Ornithorhynchus anatinus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  58. Oryctolagus cuniculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  59. Otolemur garnettii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  60. Ovis aries tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 6)
  61. Pan paniscus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 7)
  62. Pan troglodytes tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 7)
  63. Papio anubis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 7)
  64. Peromyscus maniculatus sonoriensis tRNA-Tyr
  65. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  66. Plecturocebus cupreus tRNA-OTHER
  67. Pongo abelii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 6)
  68. Procavia capensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-5-1, tRNA-Tyr-GTA-5-2)
  69. Rattus norvegicus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  70. Saimiri boliviensis boliviensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  71. Sarcophilus harrisii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 5)
  72. Sigmodon hispidus tRNA-Tyr
  73. Sorex araneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  74. Sus scrofa tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 7)
  75. Symphalangus syndactylus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  76. Taeniopygia guttata tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  77. Trichechus manatus latirostris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1)
  78. Tursiops truncatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  79. Vicugna pacos tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 7)
  80. Xenopus petersii tRNA-Tyr
  81. Xenopus tropicalis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 49)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications