Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Alligator mississippiensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3) secondary structure diagram

Alligator mississippiensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3) URS0000333F2E_8496

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUCGAUAGCUCAGCUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAUUCCGGCUCGAAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Ailuropoda melanoleuca tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  2. Anolis carolinensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 4)
  3. Balaenoptera acutorostrata scammoni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 5)
  4. Bos taurus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 7)
  5. Callithrix jacchus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 4)
  6. Callorhinchus milii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1)
  7. Canis lupus familiaris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 3)
  8. Carlito syrichta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 3)
  9. Cavia porcellus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  10. Ceratotherium simum simum tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  11. Chlorocebus sabaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  12. Choloepus hoffmanni tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4-1, tRNA-Tyr-GTA-4-2)
  13. Chrysemys picta bellii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 5)
  14. Columba livia (rock pigeon) partial tRNA-Tyr
  15. Cricetulus griseus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  16. Dasypus novemcinctus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 5)
  17. Dipodomys ordii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  18. Echinops telfairi tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  19. Eptesicus nilssonii tRNA-Tyr
  20. Equus caballus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 9)
  21. Erinaceus europaeus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  22. Felis catus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 10)
  23. Gallus gallus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  24. Geospiza fortis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1, tRNA-Tyr-GTA-1-2)
  25. Gorilla gorilla gorilla tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  26. Heterocephalus glaber tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4-1, tRNA-Tyr-GTA-4-2)
  27. Homo sapiens (human) tRNA-Tyr (anticodon GTA) 5-1 (TRY-GTA5 1 to 5)
  28. Ictidomys tridecemlineatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  29. Lamprotornis superbus tRNA-OTHER
  30. Latimeria chalumnae tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  31. Loxodonta africana tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 11)
  32. Macaca mulatta tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2, tRNA-Tyr-GTA-3 4 to 7)
  33. Meleagris gallopavo tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 3)
  34. Melopsittacus undulatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1-1)
  35. Microcebus murinus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  36. Monodelphis domestica tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  37. Mus caroli tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  38. Mus musculus castaneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1)
  39. Mus musculus domesticus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  40. Mus musculus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  41. Mus musculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  42. Mus pahari tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4-1, tRNA-Tyr-GTA-4-2)
  43. Mus spretus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1, tRNA-Tyr-GTA-3-2)
  44. Mustela putorius furo tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  45. Myotis lucifugus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  46. Nomascus leucogenys tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 3)
  47. Notamacropus eugenii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  48. Ochotona princeps tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 5)
  49. Oreochromis niloticus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-5-1)
  50. Ornithorhynchus anatinus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 9)
  51. Oryctolagus cuniculus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  52. Otolemur garnettii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  53. Ovis aries tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 6)
  54. Pan troglodytes tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 7)
  55. Papio anubis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 7)
  56. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  57. Pongo abelii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 6)
  58. Procavia capensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-5-1, tRNA-Tyr-GTA-5-2)
  59. Rattus norvegicus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2-1, tRNA-Tyr-GTA-2-2)
  60. Saimiri boliviensis boliviensis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 3)
  61. Sarcophilus harrisii tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 5)
  62. Sorex araneus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 4)
  63. Sus scrofa tRNA-Tyr (GTA) (tRNA-Tyr-GTA-4 1 to 7)
  64. Taeniopygia guttata tRNA-Tyr (GTA) (tRNA-Tyr-GTA-1 1 to 4)
  65. Trichechus manatus latirostris tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3-1)
  66. Tursiops truncatus tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 6)
  67. Vicugna pacos tRNA-Tyr (GTA) (tRNA-Tyr-GTA-3 1 to 7)
  68. Xenopus tropicalis tRNA-Tyr (GTA) (tRNA-Tyr-GTA-2 1 to 49)
2D structure Publications