Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Charadrius vociferus tRNA secondary structure diagram

Charadrius vociferus tRNA URS000030BAD5_50402

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGAGUGGCGCAGCGGAAGCGUGCUGGGCCCAUAACCCAGAGGUCGAUGGAUCGAAACCAUCCUCUGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 166 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  3. Albula glossodonta tRNA-OTHER
  4. Albula goreensis tRNA-Met
  5. Alligator mississippiensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
  6. Alligator sinensis tRNA
  7. Alosa alosa (allis shad) tRNA-Met
  8. Amazona aestiva tRNA
  9. Ameiurus melas tRNA-Met
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla (European eel) tRNA-Met
  12. Anolis carolinensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
  13. Apaloderma vittatum tRNA
  14. Aptenodytes forsteri tRNA
  15. Astyanax mexicanus tRNA
  16. Ataeniobius toweri tRNA-Met
  17. Balaenoptera acutorostrata scammoni tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  18. Balearica regulorum gibbericeps tRNA
  19. Bos taurus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  20. Buceros rhinoceros silvestris tRNA
  21. Callipepla squamata tRNA
  22. Callithrix jacchus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  23. Callorhinchus milii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 15)
  24. Calypte anna tRNA
  25. Camelus ferus tRNA
  26. Canis lupus familiaris tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
  27. Antrostomus carolinensis tRNA
  28. Cariama cristata (red-legged seriema) tRNA
  29. Carlito syrichta tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  30. Cathartes aura tRNA
  31. Cavia porcellus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  32. Ceratotherium simum simum tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  33. Chaetura pelagica tRNA
  34. Characodon lateralis tRNA-Met
  35. Chelonia mydas (green seaturtle) tRNA
  36. Chlamydotis macqueenii tRNA
  37. Chlorocebus sabaeus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  38. Choloepus hoffmanni tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  39. Chrysemys picta bellii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  40. Ciona intestinalis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  41. Ciona savignyi tRNA
  42. Colinus virginianus tRNA
  43. Colius striatus (speckled mousebird) tRNA
  44. Columba livia (Rock pigeon) tRNA
  45. Corvus brachyrhynchos (American crow) tRNA
  46. Crenichthys baileyi tRNA-iMet
  47. Cricetulus griseus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  48. Cuculus canorus (common cuckoo) tRNA
  49. Dallia pectoralis tRNA-OTHER
  50. Danionella translucida tRNA-Met
  51. Danio rerio tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 139)
  52. Dasypus novemcinctus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  53. Dipodomys ordii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  54. Echinops telfairi tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  55. Egretta garzetta tRNA
  56. Eptesicus nilssonii tRNA-Met
  57. Equus caballus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 10)
  58. Erinaceus europaeus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  59. Eschrichtius robustus tRNA-Met
  60. Eurypyga helias (sunbittern) tRNA
  61. Felis catus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  62. Ficedula albicollis tRNA
  63. Fukomys damarensis tRNA
  64. Fulmarus glacialis (northern fulmar) tRNA
  65. Gadus morhua tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 22)
  66. Gallus gallus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  67. Gasterosteus aculeatus (three-spined stickleback) tRNA
  68. Gavia stellata tRNA
  69. Geospiza fortis tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
  70. Gorilla gorilla gorilla tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  71. Haliaeetus albicilla (white-tailed eagle) tRNA
  72. Heterocephalus glaber tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  73. Hippoglossus stenolepis tRNA-Met
  74. Homo sapiens tRNA-iMet (anticodon CAT) 1-1 (TRX-CAT1 1 to 8)
  75. Ictidomys tridecemlineatus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  76. Lamprotornis superbus tRNA-OTHER
  77. Larimichthys crocea tRNA
  78. Latimeria chalumnae tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
  79. Lepisosteus oculatus (spotted gar) tRNA
  80. Leptosomus discolor tRNA
  81. Lonchura striata domestica (Bengalese finch) tRNA
  82. Loxodonta africana tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  83. Macaca mulatta tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2, tRNA-iMet-CAT-1 4 to 9)
  84. Manacus vitellinus tRNA
  85. Marmota monax tRNA.Met
  86. Megalops atlanticus tRNA-Met
  87. Meleagris gallopavo tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  88. Melopsittacus undulatus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  89. Merluccius polli tRNA-Met
  90. Merops nubicus tRNA
  91. Mesitornis unicolor (brown roatelo) tRNA
  92. Mesocricetus auratus tRNA
  93. Microcebus murinus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  94. Monodelphis domestica tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  95. Mus caroli tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  96. Mus musculus castaneus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  97. Mus musculus domesticus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  98. Mus musculus musculus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  99. Mus musculus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  100. Mus pahari tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  101. Mus spretus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  102. Mustela putorius furo tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  103. Myotis brandtii tRNA
  104. Myotis davidii tRNA
  105. Myotis lucifugus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  106. Neotoma lepida tRNA
  107. Nestor notabilis tRNA
  108. Nipponia nippon (crested ibis) tRNA
  109. Nomascus leucogenys tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  110. Notamacropus eugenii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  111. Nothobranchius furzeri tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
  112. Ochotona princeps tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  113. Ophiophagus hannah tRNA
  114. Opisthocomus hoazin tRNA
  115. Oreochromis niloticus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 16)
  116. Ornithorhynchus anatinus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 11)
  117. Oryctolagus cuniculus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  118. Oryzias latipes tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  119. Otolemur garnettii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  120. Ovis aries tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 10)
  121. Pangasianodon gigas (Mekong giant catfish) tRNA-Met
  122. Pangasianodon hypophthalmus tRNA-Met
  123. Pangasius djambal tRNA-Met
  124. Pan troglodytes tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 10)
  125. Papio anubis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  126. Patagioenas fasciata monilis tRNA
  127. Pelecanus crispus tRNA
  128. Pelobates cultripes tRNA.Met
  129. Pelodiscus sinensis tRNA
  130. Perca flavescens (yellow perch) tRNA-Met
  131. Perca fluviatilis tRNA-Met
  132. Petromyzon marinus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 93)
  133. Phaethon lepturus tRNA
  134. Phalacrocorax carbo (great cormorant) tRNA
  135. Phoenicopterus ruber ruber tRNA
  136. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  137. Dryobates pubescens tRNA
  138. Pleuronectes platessa (European plaice) tRNA-iMet
  139. Podarcis lilfordi tRNA.iMet
  140. Poecilia formosa tRNA
  141. Pongo abelii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  142. Procavia capensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 12)
  143. Pterocles gutturalis tRNA
  144. Pteropus alecto (black flying fox) tRNA
  145. Rattus norvegicus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  146. Saimiri boliviensis boliviensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  147. Salmo salar (Atlantic salmon) tRNA
  148. Sarcophilus harrisii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 11)
  149. Scleropages formosus tRNA
  150. Sorex araneus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  151. Sphaerodactylus townsendi tRNA-iMet
  152. Struthio camelus australis tRNA
  153. Sus scrofa tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  154. Taeniopygia guttata tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
  155. Takifugu rubripes tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 14)
  156. Tauraco erythrolophus tRNA
  157. Tetraodon nigroviridis tRNA
  158. Tinamus guttatus tRNA
  159. Trichechus manatus latirostris tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  160. Tupaia chinensis tRNA
  161. Tursiops truncatus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  162. Tyto alba tRNA
  163. Vicugna pacos tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  164. Xenopus laevis tRNA
  165. Xenopus tropicalis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 110)
  166. Xiphophorus maculatus (southern platyfish) tRNA
2D structure Publications