Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pterocles gutturalis (yellow-throated sandgrouse) tRNA secondary structure diagram

Pterocles gutturalis (yellow-throated sandgrouse) tRNA URS000030BAD5_240206

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGAGUGGCGCAGCGGAAGCGUGCUGGGCCCAUAACCCAGAGGUCGAUGGAUCGAAACCAUCCUCUGCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 166 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  3. Albula glossodonta tRNA-OTHER
  4. Albula goreensis tRNA-Met
  5. Alligator mississippiensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
  6. Alligator sinensis tRNA
  7. Alosa alosa (allis shad) tRNA-Met
  8. Amazona aestiva tRNA
  9. Ameiurus melas tRNA-Met
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla (European eel) tRNA-Met
  12. Anolis carolinensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
  13. Apaloderma vittatum tRNA
  14. Aptenodytes forsteri tRNA
  15. Astyanax mexicanus tRNA
  16. Ataeniobius toweri tRNA-Met
  17. Balaenoptera acutorostrata scammoni tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  18. Balearica regulorum gibbericeps tRNA
  19. Bos taurus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  20. Buceros rhinoceros silvestris tRNA
  21. Callipepla squamata tRNA
  22. Callithrix jacchus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  23. Callorhinchus milii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 15)
  24. Calypte anna tRNA
  25. Camelus ferus tRNA
  26. Canis lupus familiaris tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 4)
  27. Antrostomus carolinensis tRNA
  28. Cariama cristata (red-legged seriema) tRNA
  29. Carlito syrichta tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  30. Cathartes aura tRNA
  31. Cavia porcellus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  32. Ceratotherium simum simum tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  33. Chaetura pelagica tRNA
  34. Characodon lateralis tRNA-Met
  35. Charadrius vociferus tRNA
  36. Chelonia mydas (green seaturtle) tRNA
  37. Chlamydotis macqueenii tRNA
  38. Chlorocebus sabaeus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  39. Choloepus hoffmanni tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  40. Chrysemys picta bellii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  41. Ciona intestinalis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  42. Ciona savignyi tRNA
  43. Colinus virginianus tRNA
  44. Colius striatus (speckled mousebird) tRNA
  45. Columba livia (Rock pigeon) tRNA
  46. Corvus brachyrhynchos (American crow) tRNA
  47. Crenichthys baileyi tRNA-iMet
  48. Cricetulus griseus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  49. Cuculus canorus (common cuckoo) tRNA
  50. Dallia pectoralis tRNA-OTHER
  51. Danionella translucida tRNA-Met
  52. Danio rerio tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 139)
  53. Dasypus novemcinctus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  54. Dipodomys ordii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  55. Echinops telfairi tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  56. Egretta garzetta tRNA
  57. Eptesicus nilssonii tRNA-Met
  58. Equus caballus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 10)
  59. Erinaceus europaeus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  60. Eschrichtius robustus tRNA-Met
  61. Eurypyga helias (sunbittern) tRNA
  62. Felis catus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  63. Ficedula albicollis tRNA
  64. Fukomys damarensis tRNA
  65. Fulmarus glacialis (northern fulmar) tRNA
  66. Gadus morhua tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 22)
  67. Gallus gallus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  68. Gasterosteus aculeatus (three-spined stickleback) tRNA
  69. Gavia stellata tRNA
  70. Geospiza fortis tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
  71. Gorilla gorilla gorilla tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  72. Haliaeetus albicilla (white-tailed eagle) tRNA
  73. Heterocephalus glaber tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  74. Hippoglossus stenolepis tRNA-Met
  75. Homo sapiens tRNA-iMet (anticodon CAT) 1-1 (TRX-CAT1 1 to 8)
  76. Ictidomys tridecemlineatus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  77. Lamprotornis superbus tRNA-OTHER
  78. Larimichthys crocea tRNA
  79. Latimeria chalumnae tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
  80. Lepisosteus oculatus (spotted gar) tRNA
  81. Leptosomus discolor tRNA
  82. Lonchura striata domestica (Bengalese finch) tRNA
  83. Loxodonta africana tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  84. Macaca mulatta tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2, tRNA-iMet-CAT-1 4 to 9)
  85. Manacus vitellinus tRNA
  86. Marmota monax tRNA.Met
  87. Megalops atlanticus tRNA-Met
  88. Meleagris gallopavo tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  89. Melopsittacus undulatus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  90. Merluccius polli tRNA-Met
  91. Merops nubicus tRNA
  92. Mesitornis unicolor (brown roatelo) tRNA
  93. Mesocricetus auratus tRNA
  94. Microcebus murinus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  95. Monodelphis domestica tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  96. Mus caroli tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  97. Mus musculus castaneus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  98. Mus musculus domesticus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  99. Mus musculus musculus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  100. Mus musculus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  101. Mus pahari tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  102. Mus spretus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  103. Mustela putorius furo tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  104. Myotis brandtii tRNA
  105. Myotis davidii tRNA
  106. Myotis lucifugus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  107. Neotoma lepida tRNA
  108. Nestor notabilis tRNA
  109. Nipponia nippon (crested ibis) tRNA
  110. Nomascus leucogenys tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  111. Notamacropus eugenii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  112. Nothobranchius furzeri tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 3)
  113. Ochotona princeps tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  114. Ophiophagus hannah tRNA
  115. Opisthocomus hoazin tRNA
  116. Oreochromis niloticus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 16)
  117. Ornithorhynchus anatinus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 11)
  118. Oryctolagus cuniculus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  119. Oryzias latipes tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  120. Otolemur garnettii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  121. Ovis aries tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 10)
  122. Pangasianodon gigas (Mekong giant catfish) tRNA-Met
  123. Pangasianodon hypophthalmus tRNA-Met
  124. Pangasius djambal tRNA-Met
  125. Pan troglodytes tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 10)
  126. Papio anubis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  127. Patagioenas fasciata monilis tRNA
  128. Pelecanus crispus tRNA
  129. Pelobates cultripes tRNA.Met
  130. Pelodiscus sinensis tRNA
  131. Perca flavescens (yellow perch) tRNA-Met
  132. Perca fluviatilis tRNA-Met
  133. Petromyzon marinus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 93)
  134. Phaethon lepturus tRNA
  135. Phalacrocorax carbo (great cormorant) tRNA
  136. Phoenicopterus ruber ruber tRNA
  137. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  138. Dryobates pubescens tRNA
  139. Pleuronectes platessa (European plaice) tRNA-iMet
  140. Podarcis lilfordi tRNA.iMet
  141. Poecilia formosa tRNA
  142. Pongo abelii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  143. Procavia capensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 12)
  144. Pteropus alecto (black flying fox) tRNA
  145. Rattus norvegicus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  146. Saimiri boliviensis boliviensis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 9)
  147. Salmo salar (Atlantic salmon) tRNA
  148. Sarcophilus harrisii tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 11)
  149. Scleropages formosus tRNA
  150. Sorex araneus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 6)
  151. Sphaerodactylus townsendi tRNA-iMet
  152. Struthio camelus australis tRNA
  153. Sus scrofa tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 8)
  154. Taeniopygia guttata tRNA-iMet (CAT) (tRNA-iMet-CAT-1-1, tRNA-iMet-CAT-1-2)
  155. Takifugu rubripes tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 14)
  156. Tauraco erythrolophus tRNA
  157. Tetraodon nigroviridis tRNA
  158. Tinamus guttatus tRNA
  159. Trichechus manatus latirostris tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  160. Tupaia chinensis tRNA
  161. Tursiops truncatus tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 5)
  162. Tyto alba tRNA
  163. Vicugna pacos tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 7)
  164. Xenopus laevis tRNA
  165. Xenopus tropicalis tRNA-iMet (CAT) (tRNA-iMet-CAT-1 1 to 110)
  166. Xiphophorus maculatus (southern platyfish) tRNA
2D structure Publications