Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Astyanax mexicanus (Mexican tetra) tRNA secondary structure diagram

Astyanax mexicanus (Mexican tetra) tRNA URS00002DDD59_7994

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCAGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCUAGGUUCGACUCCUGGCUGGCUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 124 other species

  1. Acinetobacter baumannii tRNA-Arg
  2. Ailuropoda melanoleuca tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  3. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  4. Albula goreensis tRNA-Arg
  5. Alligator mississippiensis tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1)
  6. Alligator sinensis tRNA
  7. Alosa alosa (allis shad) tRNA-Arg
  8. Amazona aestiva tRNA
  9. Ameiurus melas tRNA-Arg
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla tRNA-Arg
  12. Anolis carolinensis tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  13. Aptenodytes forsteri tRNA
  14. Ataeniobius toweri tRNA-Arg
  15. Balaenoptera acutorostrata scammoni tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  16. Bos taurus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 5)
  17. Callipepla squamata tRNA
  18. Callithrix jacchus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  19. Calypte anna tRNA
  20. Camelus ferus (Wild Bactrian camel) tRNA
  21. Canis lupus familiaris tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1)
  22. Carlito syrichta tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  23. Cathartes aura (turkey vulture) tRNA
  24. Cavia porcellus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  25. Ceratotherium simum simum tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  26. Characodon lateralis tRNA-Arg
  27. Charadrius vociferus tRNA
  28. Chelonia mydas (green seaturtle) tRNA
  29. Chlorocebus sabaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  30. Choloepus hoffmanni tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  31. Chrysemys picta bellii tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  32. Colinus virginianus (northern bobwhite) tRNA
  33. Columba livia (rock pigeon) partial tRNA-Arg
  34. Crenichthys baileyi tRNA-Arg
  35. Cricetulus griseus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  36. Dallia pectoralis tRNA-OTHER
  37. Danionella translucida tRNA-Arg
  38. Danio rerio tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 116)
  39. Dasypus novemcinctus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  40. Dicentrarchus labrax (European seabass) transfer RNA-Arg
  41. Dipodomys ordii tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  42. Echinops telfairi tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  43. Eptesicus nilssonii tRNA-Arg
  44. Equus caballus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  45. Erinaceus europaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  46. Felis catus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  47. Ficedula albicollis tRNA
  48. Fukomys damarensis (Damara mole-rat) tRNA
  49. Gallus gallus tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  50. Geospiza fortis tRNA-Arg (ACG) (tRNA-Arg-ACG-5-1)
  51. Gorilla gorilla gorilla tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  52. Heterocephalus glaber tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  53. Hippoglossus stenolepis tRNA-Arg
  54. Homo sapiens tRNA-Arg (anticodon ACG) 2-1 (TRR-ACG2 1 to 4)
  55. Ictidomys tridecemlineatus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  56. Lamprotornis superbus tRNA-OTHER
  57. Larimichthys crocea tRNA
  58. Latimeria chalumnae tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  59. Lepisosteus oculatus (spotted gar) tRNA
  60. Loxodonta africana tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  61. Macaca fascicularis tRNA
  62. Macaca mulatta tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  63. Marmota monax tRNA.Arg
  64. Megalops atlanticus tRNA-Arg
  65. Meleagris gallopavo tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  66. Merluccius polli tRNA-Arg
  67. Mesocricetus auratus (golden hamster) tRNA
  68. Microcebus murinus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  69. Mus caroli tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  70. Mus musculus castaneus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  71. Mus musculus domesticus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  72. Mus musculus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  73. Mus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2, tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  74. Mus pahari tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  75. Mus spretus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  76. Mustela putorius furo tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  77. Myotis brandtii tRNA
  78. Myotis davidii tRNA
  79. Myotis lucifugus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  80. Neotoma lepida tRNA
  81. Nipponia nippon tRNA
  82. Nomascus leucogenys tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-4-1)
  83. Nothobranchius furzeri tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  84. Ochotona princeps tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  85. Ophiophagus hannah tRNA
  86. Oreochromis niloticus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 13)
  87. Ornithorhynchus anatinus tRNA-Arg (ACG) (tRNA-Arg-ACG-4 1 to 3)
  88. Oryctolagus cuniculus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  89. Oryzias latipes tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  90. Otolemur garnettii tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  91. Ovis aries tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 5)
  92. Pangasianodon gigas (Mekong giant catfish) tRNA-Arg
  93. Pangasianodon hypophthalmus tRNA-Arg
  94. Pangasius djambal tRNA-Arg
  95. Pan troglodytes tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 4)
  96. Papio anubis tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  97. Patagioenas fasciata monilis tRNA
  98. Pelobates cultripes tRNA.Arg
  99. Pelodiscus sinensis tRNA
  100. Perca flavescens tRNA-Arg
  101. Perca fluviatilis tRNA-Arg
  102. Phrynosoma platyrhinos tRNA-OTHER
  103. Podarcis lilfordi tRNA.Arg
  104. Poecilia formosa tRNA
  105. Pongo abelii tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  106. Procavia capensis tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  107. Pteropus alecto (black flying fox) tRNA
  108. Rattus norvegicus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  109. Saimiri boliviensis boliviensis tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  110. Salmo salar tRNA
  111. Scleropages formosus tRNA
  112. Sorex araneus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  113. Sphaerodactylus townsendi tRNA-Arg
  114. Struthio camelus australis tRNA
  115. Sus scrofa tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 5)
  116. Taeniopygia guttata tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  117. Takifugu rubripes tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 14)
  118. Tetraodon nigroviridis tRNA
  119. Trichechus manatus latirostris tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  120. Tupaia chinensis (Chinese tree shrew) tRNA
  121. Tursiops truncatus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  122. Vicugna pacos tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 4)
  123. Xenopus laevis tRNA
  124. Xenopus tropicalis tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
2D structure Publications