Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Vicugna pacos tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 4) secondary structure diagram

Vicugna pacos tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 4) URS00002DDD59_30538

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCAGUGGCGCAAUGGAUAACGCGUCUGACUACGGAUCAGAAGAUUCUAGGUUCGACUCCUGGCUGGCUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 124 other species

  1. Acinetobacter baumannii tRNA-Arg
  2. Ailuropoda melanoleuca tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  3. Albula glossodonta (roundjaw bonefish) tRNA-OTHER
  4. Albula goreensis tRNA-Arg
  5. Alligator mississippiensis tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1)
  6. Alligator sinensis tRNA
  7. Alosa alosa (allis shad) tRNA-Arg
  8. Amazona aestiva tRNA
  9. Ameiurus melas tRNA-Arg
  10. Anas platyrhynchos tRNA
  11. Anguilla anguilla tRNA-Arg
  12. Anolis carolinensis tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  13. Aptenodytes forsteri tRNA
  14. Astyanax mexicanus (Mexican tetra) tRNA
  15. Ataeniobius toweri tRNA-Arg
  16. Balaenoptera acutorostrata scammoni tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  17. Bos taurus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 5)
  18. Callipepla squamata tRNA
  19. Callithrix jacchus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  20. Calypte anna tRNA
  21. Camelus ferus (Wild Bactrian camel) tRNA
  22. Canis lupus familiaris tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1)
  23. Carlito syrichta tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  24. Cathartes aura (turkey vulture) tRNA
  25. Cavia porcellus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  26. Ceratotherium simum simum tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  27. Characodon lateralis tRNA-Arg
  28. Charadrius vociferus tRNA
  29. Chelonia mydas (green seaturtle) tRNA
  30. Chlorocebus sabaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  31. Choloepus hoffmanni tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  32. Chrysemys picta bellii tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  33. Colinus virginianus (northern bobwhite) tRNA
  34. Columba livia (rock pigeon) partial tRNA-Arg
  35. Crenichthys baileyi tRNA-Arg
  36. Cricetulus griseus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  37. Dallia pectoralis tRNA-OTHER
  38. Danionella translucida tRNA-Arg
  39. Danio rerio tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 116)
  40. Dasypus novemcinctus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  41. Dicentrarchus labrax (European seabass) transfer RNA-Arg
  42. Dipodomys ordii tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  43. Echinops telfairi tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  44. Eptesicus nilssonii tRNA-Arg
  45. Equus caballus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  46. Erinaceus europaeus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  47. Felis catus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  48. Ficedula albicollis tRNA
  49. Fukomys damarensis (Damara mole-rat) tRNA
  50. Gallus gallus tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  51. Geospiza fortis tRNA-Arg (ACG) (tRNA-Arg-ACG-5-1)
  52. Gorilla gorilla gorilla tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  53. Heterocephalus glaber tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1)
  54. Hippoglossus stenolepis tRNA-Arg
  55. Homo sapiens tRNA-Arg (anticodon ACG) 2-1 (TRR-ACG2 1 to 4)
  56. Ictidomys tridecemlineatus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  57. Lamprotornis superbus tRNA-OTHER
  58. Larimichthys crocea tRNA
  59. Latimeria chalumnae tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  60. Lepisosteus oculatus (spotted gar) tRNA
  61. Loxodonta africana tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  62. Macaca fascicularis tRNA
  63. Macaca mulatta tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-2-2)
  64. Marmota monax tRNA.Arg
  65. Megalops atlanticus tRNA-Arg
  66. Meleagris gallopavo tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  67. Merluccius polli tRNA-Arg
  68. Mesocricetus auratus (golden hamster) tRNA
  69. Microcebus murinus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  70. Mus caroli tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  71. Mus musculus castaneus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  72. Mus musculus domesticus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  73. Mus musculus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  74. Mus musculus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2, tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  75. Mus pahari tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  76. Mus spretus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  77. Mustela putorius furo tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  78. Myotis brandtii tRNA
  79. Myotis davidii tRNA
  80. Myotis lucifugus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  81. Neotoma lepida tRNA
  82. Nipponia nippon tRNA
  83. Nomascus leucogenys tRNA-Arg (ACG) (tRNA-Arg-ACG-2-1, tRNA-Arg-ACG-4-1)
  84. Nothobranchius furzeri tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  85. Ochotona princeps tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 4)
  86. Ophiophagus hannah tRNA
  87. Oreochromis niloticus tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 13)
  88. Ornithorhynchus anatinus tRNA-Arg (ACG) (tRNA-Arg-ACG-4 1 to 3)
  89. Oryctolagus cuniculus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  90. Oryzias latipes tRNA-Arg (ACG) (tRNA-Arg-ACG-1 1 to 4)
  91. Otolemur garnettii tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  92. Ovis aries tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 5)
  93. Pangasianodon gigas (Mekong giant catfish) tRNA-Arg
  94. Pangasianodon hypophthalmus tRNA-Arg
  95. Pangasius djambal tRNA-Arg
  96. Pan troglodytes tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 4)
  97. Papio anubis tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  98. Patagioenas fasciata monilis tRNA
  99. Pelobates cultripes tRNA.Arg
  100. Pelodiscus sinensis tRNA
  101. Perca flavescens tRNA-Arg
  102. Perca fluviatilis tRNA-Arg
  103. Phrynosoma platyrhinos tRNA-OTHER
  104. Podarcis lilfordi tRNA.Arg
  105. Poecilia formosa tRNA
  106. Pongo abelii tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  107. Procavia capensis tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  108. Pteropus alecto (black flying fox) tRNA
  109. Rattus norvegicus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  110. Saimiri boliviensis boliviensis tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 3)
  111. Salmo salar tRNA
  112. Scleropages formosus tRNA
  113. Sorex araneus tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
  114. Sphaerodactylus townsendi tRNA-Arg
  115. Struthio camelus australis tRNA
  116. Sus scrofa tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 5)
  117. Taeniopygia guttata tRNA-Arg (ACG) (tRNA-Arg-ACG-4-1, tRNA-Arg-ACG-4-2)
  118. Takifugu rubripes tRNA-Arg (ACG) (tRNA-Arg-ACG-2 1 to 14)
  119. Tetraodon nigroviridis tRNA
  120. Trichechus manatus latirostris tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1, tRNA-Arg-ACG-3-2)
  121. Tupaia chinensis (Chinese tree shrew) tRNA
  122. Tursiops truncatus tRNA-Arg (ACG) (tRNA-Arg-ACG-3-1)
  123. Xenopus laevis tRNA
  124. Xenopus tropicalis tRNA-Arg (ACG) (tRNA-Arg-ACG-3 1 to 3)
2D structure Publications