Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-429 URS00002D8367_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-429: Ssc-mir-429 is a microRNA that has been found to be significantly downregulated in a study [PMC4613317]. The specific sequence of ssc-mir-429 is provided as sense: 5′-UAAUACUGUCUGGUAAUGCCGU-3′ and antisense: 5′-GGCAUUACCAGACAGUAUUAUU-3′ [PMC5187847]. This microRNA, along with other miRNAs, plays a role in regulating the expression of LPIN1 [PMC9859044]. Additionally, MSTRG.19948.1, an lncRNA, can act as a competing endogenous RNA (ceRNA) and affect the expression of LPIN1 by binding to ssc-mir-429 [PMC9859044]. The target genes of ssc-mir-429 include LDHA, which is expressed at higher levels in hypoxic conditions and may contribute to the accumulation of lactic acid and increased apoptosis in lung diseases [PMC8861501]. Ssc-mir-429 is also one of the six differentially expressed miRNAs found in multiple pairs in a study [PMC7222822]. Overall, ssc-mir-429 has been implicated in various biological processes and may have important regulatory functions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGUCUGGUAAUGCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis Ami-Mir-8-P3a_3p (mature (guide))
  2. Anolis carolinensis aca-miR-429-3p
  3. Bos taurus bta-miR-429
  4. Callorhinchus milii Cmi-Mir-8-P3a_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-429
  6. Cavia porcellus cpo-miR-429-3p
  7. Chrysemys picta bellii Cpi-Mir-8-P3a_3p (mature (guide))
  8. Chrysemys picta cpi-miR-429-3p
  9. Columba livia cli-miR-429-3p
  10. Cricetulus griseus cgr-miR-429
  11. Cyprinus carpio ccr-miR-429
  12. Danio rerio dre-miR-429a
  13. Dasypus novemcinctus dno-miR-429-3p
  14. Gadus morhua gmo-miR-429-3p
  15. Gallus gallus gga-miR-429-3p
  16. Gekko japonicus Gja-Mir-8-P3a_3p (mature (guide))
  17. Haplochromis burtoni abu-miR-429b
  18. Latimeria chalumnae (coelacanth) Lch-Mir-8-P3a_3p (mature (guide))
  19. Lepisosteus oculatus (spotted gar) Loc-Mir-8-P3a_3p (mature (guide))
  20. Maylandia zebra mze-miR-429b
  21. Microcaecilia unicolor Mun-Mir-8-P3a_3p (mature (guide))
  22. Monopterus albus (swamp eel) Mal-Mir-8-P3a_3p (mature (guide))
  23. Mus musculus mmu-miR-429-3p
  24. Neolamprologus brichardi (lyretail cichlid) nbr-miR-429b
  25. Oreochromis niloticus oni-miR-429b
  26. Ornithorhynchus anatinus (platypus) oan-miR-429-3p
  27. Pteropus alecto pal-miR-429-3p
  28. Pundamilia nyererei pny-miR-429b
  29. Python bivittatus pbv-miR-429-3p
  30. Rattus norvegicus rno-miR-429
  31. Scyliorhinus torazame (cloudy catshark) Sto-Mir-8-P3a_3p (mature (guide))
  32. Sphenodon punctatus Spt-Mir-8-P3a_3p (mature (guide))
  33. Takifugu rubripes fru-miR-429
  34. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-429
  35. Tor tambroides miR-429a
  36. Xenopus laevis xla-miR-429-3p
  37. Xenopus tropicalis (tropical clawed frog) xtr-miR-429
Publications