Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-429-3p URS00002D8367_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-429: Gga-mir-429 is a microRNA (miRNA) that has been identified as a potential regulator in chicken resistance to Avian Pathogenic Escherichia coli (APEC) infection [PMC9521048]. It has been found to regulate the platelet-derived growth factor (PDGF) and Wnt signaling pathways by targeting TMEFF2 and SHISA2 [PMC9521048]. In a study comparing differentially expressed miRNAs in chicken fat lines, gga-mir-429 was found to be upregulated [PMC4326283]. It was also uniquely detected in samples infected with Marek's Disease Virus (MDV) [PMC3511444]. Overexpression of gga-mir-429 has been shown to inhibit the expression of TMEFF2 and SHISA2, as well as regulate the PDGF and Wnt signaling pathways in chicken macrophages [PMC9266748]. In relation to APEC pathology, gga-mir-429 expression was found to be upregulated in infected groups compared to the non-infected group [PMC5203650]. Through reporter gene systems, it has been suggested that gga-mir-429 directly inhibits TMEFF2 and SHISA2 expression by binding to their 3' UTRs, while indirectly inhibiting CDC20 expression through other mechanisms [PMC5203650]. Furthermore, gga-mir-429 has been shown to downregulate the mRNA expression of its target genes TMEFF2 and SHISA2 in immune cells [PMC5203650]. Overall, gga-mir-429 is considered a potential candidate involved in APEC resistance and its regulatory mechanisms warrant further investigation [PMC5203650][PMC5573731][PMC3436634][PMC5187847].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUACUGUCUGGUAAUGCCGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Alligator mississippiensis Ami-Mir-8-P3a_3p (mature (guide))
  2. Anolis carolinensis aca-miR-429-3p
  3. Bos taurus bta-miR-429
  4. Callorhinchus milii Cmi-Mir-8-P3a_3p (mature (guide))
  5. Canis lupus familiaris cfa-miR-429
  6. Cavia porcellus cpo-miR-429-3p
  7. Chrysemys picta bellii Cpi-Mir-8-P3a_3p (mature (guide))
  8. Chrysemys picta cpi-miR-429-3p
  9. Columba livia cli-miR-429-3p
  10. Cricetulus griseus cgr-miR-429
  11. Cyprinus carpio ccr-miR-429
  12. Danio rerio dre-miR-429a
  13. Dasypus novemcinctus dno-miR-429-3p
  14. Gadus morhua gmo-miR-429-3p
  15. Gekko japonicus Gja-Mir-8-P3a_3p (mature (guide))
  16. Haplochromis burtoni abu-miR-429b
  17. Latimeria chalumnae (coelacanth) Lch-Mir-8-P3a_3p (mature (guide))
  18. Lepisosteus oculatus (spotted gar) Loc-Mir-8-P3a_3p (mature (guide))
  19. Maylandia zebra mze-miR-429b
  20. Microcaecilia unicolor Mun-Mir-8-P3a_3p (mature (guide))
  21. Monopterus albus (swamp eel) Mal-Mir-8-P3a_3p (mature (guide))
  22. Mus musculus mmu-miR-429-3p
  23. Neolamprologus brichardi (lyretail cichlid) nbr-miR-429b
  24. Oreochromis niloticus oni-miR-429b
  25. Ornithorhynchus anatinus (platypus) oan-miR-429-3p
  26. Pteropus alecto pal-miR-429-3p
  27. Pundamilia nyererei pny-miR-429b
  28. Python bivittatus pbv-miR-429-3p
  29. Rattus norvegicus rno-miR-429
  30. Scyliorhinus torazame (cloudy catshark) Sto-Mir-8-P3a_3p (mature (guide))
  31. Sphenodon punctatus Spt-Mir-8-P3a_3p (mature (guide))
  32. Sus scrofa ssc-miR-429
  33. Takifugu rubripes fru-miR-429
  34. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-429
  35. Tor tambroides miR-429a
  36. Xenopus laevis xla-miR-429-3p
  37. Xenopus tropicalis (tropical clawed frog) xtr-miR-429
Publications