v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callorhinchus milii (elephant shark) eshark_mir-30_1 URS00002933B6_7868

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUAAACAUCCUUGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Anolis carolinensis (green anole) aca-miR-30e-5p
  2. Callithrix jacchus cja-miR-30e
  3. Cricetulus griseus cgr-miR-30e-5p
  4. Gallus gallus Gallus_gallus piRNA piR-gga-1116
  5. Gorilla gorilla gorilla ggo-miR-30e (MIR30E)
  6. Gorilla gorilla ggo-miR-30e
  7. Monodelphis domestica mdo-miR-30d-5p
  8. Mus musculus Mus_musculus piRNA piR-mmu-6386246
  9. Ornithorhynchus anatinus (platypus) oan-miR-30e-5p
  10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1691498