Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) mdo-miR-30d-5p URS00002933B6_13616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUUGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Anolis carolinensis (green anole) aca-miR-30e-5p
  2. Callithrix jacchus cja-miR-30e
  3. Callorhinchus milii eshark_mir-30_1
  4. Cricetulus griseus cgr-miR-30e-5p
  5. Gallus gallus Gallus_gallus piRNA piR-gga-1116
  6. Gorilla gorilla gorilla ggo-miR-30e (MIR30E)
  7. Gorilla gorilla ggo-miR-30e
  8. Mus musculus Mus_musculus piRNA piR-mmu-6386246
  9. Ornithorhynchus anatinus (platypus) oan-miR-30e-5p
  10. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1691498
Publications