Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Ser (UCN) 1 (MT-TS1) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Ser (UCN) 1 (MT-TS1) URS000025B782_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TS1: MT-TS1 is a mitochondrial gene that is involved in nonsyndromic hearing loss and liver pathogenesis. It is one of the mitochondrial genes that were tested in a study using tiered ES, which reported a diagnostic rate of 21% [PMC7443516]. MT-TS1 has also been identified as a potential biomarker for liver pathogenesis, as it was found to be differentially expressed [PMC5964116]. The deletion of the DHU-arm in MT-TS1 is commonly reported in other metazoan mitogenomes [PMC8727539]. Additionally, MT-TS1 was found to be highly elevated in Caco-2 cells cocultured with Salmonella compared to cells without infection [PMC10076011]. Mutations in MT-TS1 have been documented in cases of hearing loss and were detected using Sanger sequencing [PMC5320477]. Other mitochondrial tRNA encoding genes, including MT-TF, MT-TH, MT-T1, MT-TL1, and MT-TP have also been associated with hearing loss [PMC9036286]. In a screening study for hearing loss, the single protein-coding exon of GJB2 and the mitochondrial genes including MT-RNR1, MT-TS1, and MT-TL1 were sequenced using custom designed primers [PMC8738750].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAAAAGUCAUGGAGGCCAUGGGGUUGGCUUGAAACCAGCUUUGGGGGGUUCGAUUCCUUCCUUUUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Bacillus thuringiensis tRNA-OTHER
  2. Homo heidelbergensis (Heidelberg man) tRNA-Ser
  3. Homo sapiens neanderthalensis tRNA-Ser
  4. Homo sapiens subsp. 'Denisova' (Denisova hominin) tRNA-Ser
  5. Pseudomonas avellanae tRNA-Ser
2D structure Publications