v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens subsp. 'Denisova' (Denisova hominin) tRNA-Ser secondary structure diagram

Homo sapiens subsp. 'Denisova' (Denisova hominin) tRNA-Ser URS000025B782_741158

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAAAAAGUCAUGGAGGCCAUGGGGUUGGCUUGAAACCAGCUUUGGGGGGUUCGAUUCCUUCCUUUUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Bacillus thuringiensis tRNA-OTHER
  2. Homo heidelbergensis (Heidelberg man) tRNA-Ser
  3. Homo sapiens mitochondrially encoded tRNA-Ser (UCN) 1 (MT-TS1)
  4. Homo sapiens neanderthalensis tRNA-Ser
  5. Pseudomonas avellanae tRNA-Ser
 2D structure