Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Neolamprologus brichardi (lyretail cichlid) nbr-miR-456 URS0000246F99_32507

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGCUGGUUAGAUGGUUGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Danio rerio (zebrafish) dre-miR-456
  2. Eptatretus burgeri Ebu-Mir-456_3p (mature (guide))
  3. Gadus morhua gmo-miR-456-3p
  4. Gallus gallus (chicken) gga-miR-456-3p
  5. Haplochromis burtoni abu-miR-456
  6. Ictalurus punctatus ipu-miR-456
  7. Maylandia zebra (zebra mbuna) mze-miR-456
  8. Monopterus albus Mal-Mir-456_3p (mature (guide))
  9. Ophiophagus hannah (king cobra) oha-miR-456
  10. Oreochromis niloticus oni-miR-456
  11. Petromyzon marinus pma-miR-456
  12. Pundamilia nyererei pny-miR-456
  13. Salmo salar ssa-miR-456-3p
  14. Tor tambroides (Thai mahseer) miR-456
  15. Xenopus laevis xla-miR-456
  16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3655030