Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-456 URS0000246F99_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-mir-456: Dre-mir-456 is a miRNA family that has been studied in the early development of chicken and zebrafish [PMC3932949]. In zebrafish, the dre-mir-456 family was found to be highly expressed in the 16-cell stage [PMC3932949]. Quantitative real-time PCR assays were performed to determine the expression levels of dre-mir-456, along with three other known miRNAs (dre-miR-22a, dre-miR-206, and dre-miR-192) [PMC3932949]. These miRNAs were selected based on their known or potential roles in zebrafish early development [PMC3932949]. Additionally, the expression profiles of dre-mir-456 and other non-human miRNAs from zebrafish were quantified to confirm their presence in human cells and body fluids [PMC5478184]. The mean Ct value for dre-mir-456 was found to be 38.77 [PMC5478184]. The use of non-human miRNAs from zebrafish (such as dre-mir-456) that are not ingested in human food was important for confirming a threshold for quantification [PMC5478184]. Overall, these studies highlight the significance of dre-mir-456 and its potential role in early development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGGCUGGUUAGAUGGUUGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Eptatretus burgeri Ebu-Mir-456_3p (mature (guide))
  2. Gadus morhua gmo-miR-456-3p
  3. Gallus gallus (chicken) gga-miR-456-3p
  4. Haplochromis burtoni abu-miR-456
  5. Ictalurus punctatus ipu-miR-456
  6. Maylandia zebra (zebra mbuna) mze-miR-456
  7. Monopterus albus Mal-Mir-456_3p (mature (guide))
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-456
  9. Ophiophagus hannah (king cobra) oha-miR-456
  10. Oreochromis niloticus oni-miR-456
  11. Petromyzon marinus pma-miR-456
  12. Pundamilia nyererei pny-miR-456
  13. Salmo salar ssa-miR-456-3p
  14. Tor tambroides (Thai mahseer) miR-456
  15. Xenopus laevis xla-miR-456
  16. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3655030
Publications