Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-156124

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-156124 URS000023BE29_9031

23 nucleotides
1 database (PirBase)
Found in 10 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGGAGACGCGGCCCUGUUGGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Cavia porcellus cpo-miR-139-3p
Cervus elaphus cel-miR-139
Cricetulus griseus cgr-miR-139-3p
Dasypus novemcinctus dno-miR-139-3p
Eptesicus fuscus efu-miR-139
Homo sapiens hsa-miR-139-3p
Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-33730046
Oryctolagus cuniculus ocu-miR-139-3p
Pteropus alecto (black flying fox) pal-miR-139-3p
Sus scrofa (pig) ssc-miR-139-3p