Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-33730046 URS000023BE29_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGACGCGGCCCUGUUGGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Cavia porcellus cpo-miR-139-3p
  2. Cervus elaphus cel-miR-139
  3. Cricetulus griseus cgr-miR-139-3p
  4. Dasypus novemcinctus dno-miR-139-3p
  5. Eptesicus fuscus efu-miR-139
  6. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-156124
  7. Homo sapiens hsa-miR-139-3p
  8. Oryctolagus cuniculus ocu-miR-139-3p
  9. Pteropus alecto (black flying fox) pal-miR-139-3p
  10. Sus scrofa (pig) ssc-miR-139-3p