v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Trachypithecus poliocephalus (White-headed langur) tRNA-Met secondary structure diagram

Trachypithecus poliocephalus (White-headed langur) tRNA-Met URS00002116D6_465719

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUAUAUCCUUCCCGUACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Homo heidelbergensis (Heidelberg man) tRNA-Met
  2. Homo sapiens (human) tRNA-Met
  3. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Met
  4. Pan troglodytes troglodytes tRNA-Met
  5. Pan troglodytes verus tRNA-Met
  6. Presbytis femoralis tRNA-Met
  7. Presbytis femoralis femoralis tRNA-Met
  8. Presbytis femoralis percura tRNA-Met
  9. Presbytis melalophos tRNA-Met
  10. Pygathrix nigripes tRNA-Met
  11. Rhinopithecus avunculus tRNA-Met
  12. Rhinopithecus brelichi (Gray snub-nosed monkey) tRNA-Met
  13. Rhinopithecus roxellana tRNA (ENSRROG00000000009.1)
  14. Trachypithecus cristatus tRNA-Met
  15. Trachypithecus delacouri (Delacour's langur) tRNA-Met
  16. Trachypithecus francoisi (Francois's langur) tRNA-Met
  17. Trachypithecus geei tRNA-Met
  18. Trachypithecus germaini tRNA-Met
  19. Trachypithecus mauritius tRNA-Met
  20. Trachypithecus phayrei (Phayre's leaf monkey) tRNA-Met
 2D structure