Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Presbytis femoralis femoralis tRNA-Met secondary structure diagram

Presbytis femoralis femoralis tRNA-Met URS00002116D6_1840579

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUAUAUCCUUCCCGUACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Homo heidelbergensis (Heidelberg man) tRNA-Met
  2. Homo sapiens (human) tRNA-Met
  3. Homo sapiens subsp. 'Denisova' subsp. 'Denisova' (Denisova hominin) transfer RNA-Met
  4. Pan troglodytes troglodytes tRNA-Met
  5. Pan troglodytes verus tRNA-Met
  6. Presbytis femoralis tRNA-Met
  7. Presbytis femoralis percura tRNA-Met
  8. Presbytis melalophos tRNA-Met
  9. Pygathrix nigripes tRNA-Met
  10. Rhinopithecus avunculus tRNA-Met
  11. Rhinopithecus brelichi (Gray snub-nosed monkey) tRNA-Met
  12. Rhinopithecus roxellana tRNA (ENSRROG00000000009.1)
  13. Trachypithecus cristatus tRNA-Met
  14. Trachypithecus delacouri (Delacour's langur) tRNA-Met
  15. Trachypithecus francoisi (Francois's langur) tRNA-Met
  16. Trachypithecus geei tRNA-Met
  17. Trachypithecus germaini tRNA-Met
  18. Trachypithecus mauritius tRNA-Met
  19. Trachypithecus phayrei (Phayre's leaf monkey) tRNA-Met
  20. Trachypithecus poliocephalus tRNA-Met
2D structure