v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-His (CAU/C) (MT-TH) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-His (CAU/C) (MT-TH) URS00001FBD75_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TH: MT-TH is a mitochondrial tRNA that is present in the H-strand [PMC9657367]. Cleavage at MT-TH occurs rapidly, as indicated by the absence of intermediate processing products in wild-type mitochondria [PMC5435911]. In a study investigating gene expression in different tissues, MT-TH was found to be differentially expressed [PMC9028063]. In grade 3, downregulation of mitochondrial-related transcripts including MT-TH was observed, and these gene expressions were not reported in HD [PMC9777612]. In a study of neonates in the Chongqing area, common mutations were found in genes including MT-TH [PMC8084083].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUAAAUAUAGUUUAACCAAAACAUCAGAUUGUGAAUCUGACAACAGAGGCUUACGACCCCUUAUUUACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Cloning vector pRS316-1B9 tRNA-His
 2D structure Publications