Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Chelonia mydas (green seaturtle) tRNA secondary structure diagram

Chelonia mydas (green seaturtle) tRNA URS00001D9AFB_8469

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCGGUGGCCAAGUGGUAAGGCGUCGGUCUCGUAAACCGAAGAUCACGGGUUCGAACCCCGUCCGUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 85 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  3. Alligator mississippiensis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  4. Alligator sinensis (Chinese alligator) tRNA
  5. Anas platyrhynchos tRNA
  6. Bos taurus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  7. Callipepla squamata (scaled quail) tRNA
  8. Callithrix jacchus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  9. Calypte anna tRNA
  10. Camelus ferus (Wild Bactrian camel) tRNA
  11. Canis lupus familiaris tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  12. Carlito syrichta tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  13. Ceratotherium simum simum tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  14. Chaetura pelagica tRNA
  15. Chelydra serpentina tRNA-Thr
  16. Chlorocebus sabaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  17. Choloepus hoffmanni tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  18. Chrysemys picta bellii tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  19. Colinus virginianus (northern bobwhite) tRNA
  20. Cricetulus griseus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  21. Dasypus novemcinctus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  22. Dipodomys ordii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1, tRNA-Thr-CGT-3-2)
  23. Echinops telfairi tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  24. Eptesicus nilssonii tRNA-Thr
  25. Erinaceus europaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  26. Felis catus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  27. Ficedula albicollis tRNA
  28. Fukomys damarensis tRNA
  29. Gallus gallus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  30. Gorilla gorilla gorilla tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  31. Heterocephalus glaber tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  32. Homo sapiens tRNA-Thr (anticodon CGT) 2-1 (TRT-CGT2-1)
  33. Ictidomys tridecemlineatus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  34. Lamprotornis superbus tRNA-OTHER
  35. Lepisosteus oculatus tRNA
  36. Lonchura striata domestica (Bengalese finch) tRNA
  37. Loxodonta africana tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  38. Macaca mulatta tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  39. Marmota monax (woodchuck) tRNA.Thr
  40. Megalops atlanticus tRNA-Thr
  41. Meleagris gallopavo tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  42. Mesocricetus auratus (golden hamster) tRNA
  43. Microcebus murinus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  44. Monodelphis domestica tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  45. Mus caroli tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  46. Mus musculus castaneus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  47. Mus musculus domesticus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  48. Mus musculus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  49. Mus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-3-1)
  50. Mus pahari tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  51. Mus spretus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  52. Myotis brandtii tRNA
  53. Myotis davidii tRNA
  54. Myotis lucifugus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  55. Neotoma lepida (desert woodrat) tRNA
  56. Nomascus leucogenys tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  57. Notamacropus eugenii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  58. Ochotona princeps tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  59. Ophiophagus hannah tRNA
  60. Ornithorhynchus anatinus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  61. Oryctolagus cuniculus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  62. Otolemur garnettii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  63. Ovis aries tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  64. Pan troglodytes tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  65. Papio anubis tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  66. Patagioenas fasciata monilis tRNA
  67. Pelobates cultripes (western spadefoot toad) tRNA.Thr
  68. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  69. Podarcis lilfordi tRNA.Thr
  70. Pongo abelii tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  71. Procavia capensis tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  72. Pteropus alecto tRNA
  73. Rattus norvegicus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  74. Saimiri boliviensis boliviensis tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  75. Sarcophilus harrisii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  76. Sorex araneus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  77. Sphaerodactylus townsendi tRNA-Thr
  78. Sus scrofa tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  79. Taeniopygia guttata tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  80. Trichechus manatus latirostris tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  81. Tupaia chinensis (Chinese tree shrew) tRNA
  82. Tursiops truncatus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  83. Vicugna pacos tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  84. Xenopus laevis tRNA
  85. Xenopus tropicalis tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1)
2D structure Publications