Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Xenopus tropicalis tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1) secondary structure diagram

Xenopus tropicalis tRNA-Thr (CGT) (tRNA-Thr-CGT-5-1) URS00001D9AFB_8364

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCGGUGGCCAAGUGGUAAGGCGUCGGUCUCGUAAACCGAAGAUCACGGGUUCGAACCCCGUCCGUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 85 other species

  1. Acanthisitta chloris tRNA
  2. Ailuropoda melanoleuca tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  3. Alligator mississippiensis tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  4. Alligator sinensis (Chinese alligator) tRNA
  5. Anas platyrhynchos tRNA
  6. Bos taurus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  7. Callipepla squamata (scaled quail) tRNA
  8. Callithrix jacchus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  9. Calypte anna tRNA
  10. Camelus ferus (Wild Bactrian camel) tRNA
  11. Canis lupus familiaris tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  12. Carlito syrichta tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  13. Ceratotherium simum simum tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  14. Chaetura pelagica tRNA
  15. Chelonia mydas (green seaturtle) tRNA
  16. Chelydra serpentina tRNA-Thr
  17. Chlorocebus sabaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  18. Choloepus hoffmanni tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  19. Chrysemys picta bellii tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  20. Colinus virginianus (northern bobwhite) tRNA
  21. Cricetulus griseus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  22. Dasypus novemcinctus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  23. Dipodomys ordii tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1, tRNA-Thr-CGT-3-2)
  24. Echinops telfairi tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  25. Eptesicus nilssonii tRNA-Thr
  26. Erinaceus europaeus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  27. Felis catus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  28. Ficedula albicollis tRNA
  29. Fukomys damarensis tRNA
  30. Gallus gallus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  31. Gorilla gorilla gorilla tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  32. Heterocephalus glaber tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  33. Homo sapiens tRNA-Thr (anticodon CGT) 2-1 (TRT-CGT2-1)
  34. Ictidomys tridecemlineatus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  35. Lamprotornis superbus tRNA-OTHER
  36. Lepisosteus oculatus tRNA
  37. Lonchura striata domestica (Bengalese finch) tRNA
  38. Loxodonta africana tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  39. Macaca mulatta tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  40. Marmota monax (woodchuck) tRNA.Thr
  41. Megalops atlanticus tRNA-Thr
  42. Meleagris gallopavo tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  43. Mesocricetus auratus (golden hamster) tRNA
  44. Microcebus murinus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  45. Monodelphis domestica tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  46. Mus caroli tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  47. Mus musculus castaneus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  48. Mus musculus domesticus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  49. Mus musculus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  50. Mus musculus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1, tRNA-Thr-CGT-3-1)
  51. Mus pahari tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  52. Mus spretus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  53. Myotis brandtii tRNA
  54. Myotis davidii tRNA
  55. Myotis lucifugus tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  56. Neotoma lepida (desert woodrat) tRNA
  57. Nomascus leucogenys tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  58. Notamacropus eugenii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  59. Ochotona princeps tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  60. Ophiophagus hannah tRNA
  61. Ornithorhynchus anatinus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  62. Oryctolagus cuniculus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  63. Otolemur garnettii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  64. Ovis aries tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  65. Pan troglodytes tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  66. Papio anubis tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  67. Patagioenas fasciata monilis tRNA
  68. Pelobates cultripes (western spadefoot toad) tRNA.Thr
  69. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  70. Podarcis lilfordi tRNA.Thr
  71. Pongo abelii tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  72. Procavia capensis tRNA-Thr (CGT) (tRNA-Thr-CGT-4-1)
  73. Pteropus alecto tRNA
  74. Rattus norvegicus tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  75. Saimiri boliviensis boliviensis tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  76. Sarcophilus harrisii tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  77. Sorex araneus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  78. Sphaerodactylus townsendi tRNA-Thr
  79. Sus scrofa tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  80. Taeniopygia guttata tRNA-Thr (CGT) (tRNA-Thr-CGT-1-1)
  81. Trichechus manatus latirostris tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  82. Tupaia chinensis (Chinese tree shrew) tRNA
  83. Tursiops truncatus tRNA-Thr (CGT) (tRNA-Thr-CGT-2-1)
  84. Vicugna pacos tRNA-Thr (CGT) (tRNA-Thr-CGT-3-1)
  85. Xenopus laevis tRNA
2D structure Publications