v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-26a URS000019B0F7_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-miR-26a: Bta-mir-26a is a microRNA that has been studied in bovine ovarian and testicular tissues. It is among the top 10 abundantly expressed miRNAs in these tissues [PMC4438052]. DMRs have been detected within 10-kb upstream regions of the predicted TSS regions for bta-mir-26a [PMC6691986]. This suggests that DNA methylation may play a role in regulating the expression of bta-mir-26a [PMC6691986]. References: - [PMC4438052]: Li, Z., Liu, H., Jin, X., Lo, L. J., Liu, J., & Liu, Z. (2015). Comparative miRNAome analysis revealed different miRNA expression profiles in bovine ovarian and testicular tissues related to fertility. Reproductive biology and endocrinology: RB&E, 13(1), 81. - [PMC6691986]: Liang, G., Zhang, Y., & Zhang, Y. (2019). DNA methylation analysis: from bisulfite sequencing to differentially methylated region detection methods. Journal of genetics and genomics= Yi chuan xue bao, 46(7), 343–351.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UUCAAGUAAUCCAGGAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Alligator mississippiensis ami-miR-26-5p
  2. Anolis carolinensis (green anole) aca-miR-26-3-5p
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26a
  4. Callorhinchus milii Cmi-Mir-26-P1_5p (mature (guide))
  5. Canis lupus familiaris (dog) cfa-miR-26a
  6. Capra hircus (goat) chi-miR-26a-5p
  7. Cavia porcellus (domestic guinea pig) cpo-miR-26a-5p
  8. Cervus elaphus cel-miR-26a
  9. Chiloscyllium plagiosum microRNA cpl-miR-26
  10. Chrysemys picta bellii Cpi-Mir-26-P1_5p (mature (guide))
  11. Chrysemys picta (Painted turtle) cpi-miR-26-5p
  12. Columba livia (rock pigeon) cli-miR-26-5p
  13. Cyprinus carpio (common carp) ccr-miR-26a
  14. Danio rerio (zebrafish) dre-miR-26a-5p
  15. Dasypus novemcinctus dno-miR-26a-5p
  16. Daubentonia madagascariensis (aye-aye) dma-miR-26a
  17. Echinops telfairi Ete-Mir-26-P1_5p (mature (guide))
  18. Eptatretus burgeri (inshore hagfish) Ebu-Mir-26-P5_5p (mature (guide))
  19. Equus caballus eca-miR-26a
  20. Gadus morhua gmo-miR-26a-5p
  21. Gallus gallus (chicken) gga-miR-26a-2-5p
  22. Gekko japonicus Gja-Mir-26-P1_5p (mature (guide))
  23. Gorilla gorilla gorilla ggo-miR-26a (MIR26A)
  24. Gorilla gorilla (western gorilla) ggo-miR-26a
  25. Haplochromis burtoni abu-miR-26a
  26. Homo sapiens hsa-miR-26a-5p
  27. Ictalurus punctatus (channel catfish) ipu-miR-26a
  28. Lagothrix lagotricha (brown woolly monkey) lla-miR-26a
  29. Latimeria chalumnae Lch-Mir-26-P4_5p (mature (guide))
  30. Lepisosteus oculatus (spotted gar) Loc-Mir-26-P1_5p (mature (guide))
  31. Macaca mulatta (Rhesus monkey) mml-miR-26a-5p
  32. Macaca nemestrina mne-miR-26a
  33. Maylandia zebra (zebra mbuna) mze-miR-26a
  34. Microcaecilia unicolor Mun-Mir-26-P4_5p (mature (guide))
  35. Microcebus murinus (gray mouse lemur) mmr-miR-26a
  36. Monodelphis domestica Mdo-Mir-26-P1_5p (mature (guide))
  37. Monopterus albus Mal-Mir-26-P1b_5p (mature (guide))
  38. Mus musculus mmu-miR-26a-5p
  39. Neolamprologus brichardi (lyretail cichlid) nbr-miR-26a
  40. Nomascus leucogenys nle-miR-26a
  41. Ophiophagus hannah oha-miR-26-5p
  42. Oreochromis niloticus (Nile tilapia) oni-miR-26a
  43. Ornithorhynchus anatinus (platypus) oan-miR-26-5p
  44. Oryctolagus cuniculus (rabbit) ocu-miR-26a-5p
  45. Otolemur garnettii (small-eared galago) oga-miR-26a
  46. Ovis aries (sheep) oar-miR-26a
  47. Pan paniscus ppa-miR-26a
  48. Pan troglodytes ptr-miR-26a
  49. Papio hamadryas pha-miR-26a
  50. Petromyzon marinus pma-miR-26a-5p
  51. Pongo pygmaeus (Bornean orangutan) ppy-miR-26a
  52. Pteropus alecto (black flying fox) pal-miR-26a-5p
  53. Pundamilia nyererei pny-miR-26a
  54. Python bivittatus (Burmese python) pbv-miR-26-5p
  55. Rattus norvegicus rno-miR-26a-5p
  56. Saimiri boliviensis boliviensis sbo-miR-26a
  57. Salmo salar ssa-miR-26a-5p
  58. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-26-P1_5p (mature (guide))
  59. Scyliorhinus torazame (cloudy catshark) Sto-Mir-26-P1_5p (mature (guide))
  60. Sphenodon punctatus (tuatara) Spt-Mir-26-P1_5p (mature (guide))
  61. Sus scrofa ssc-miR-26a
  62. Taeniopygia guttata (zebra finch) tgu-miR-26-5p
  63. Takifugu rubripes fru-miR-26
  64. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-26
  65. Tor tambroides miR-26a-5p
  66. Tupaia chinensis (Chinese tree shrew) tch-miR-26a-5p
  67. Xenopus laevis xla-miR-26-5p
  68. Xenopus tropicalis Xtr-Mir-26-P1_5p (mature (guide))
 Publications