Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-26a URS000019B0F7_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-26a: Ssc-mir-26a is a microRNA that has been evaluated for its stability using the geNorm v3.5 algorithm [PMC4704413]. It is one of the top nine most abundant miRNAs shared between two groups [PMC4613317]. In a study, it was found that ssc-mir-26a was significantly upregulated and differentially expressed by at least four-fold [PMC6560770]. In another study, ssc-mir-26a was selected as one of the ten candidate miRNAs to study its expression stability in different porcine tissues and breeds [PMC3438195]. Additionally, it has been reported that ssc-mir-26a is one of the most abundant miRNAs during porcine skeletal muscle developmental stages [PMC5536276]. References: - [PMC4704413]: Reference for the evaluation of stability using geNorm v3.5 algorithm. - [PMC4613317]: Reference for ssc-mir-26a being one of the top nine most abundant miRNAs shared between two groups. - [PMC6560770]: Reference for ssc-mir-26a being significantly upregulated and differentially expressed by at least four-fold. - [PMC3438195]: Reference for ssc-mir-26a being selected as one of ten candidate miRNAs to study its expression stability in different porcine tissues and breeds. -[PMC5536276]: Reference for ssc-mir-26a being one of the most abundant miRNAs during porcine skeletal muscle developmental stages.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAAGUAAUCCAGGAUAGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 68 other species

  1. Alligator mississippiensis ami-miR-26-5p
  2. Anolis carolinensis (green anole) aca-miR-26-3-5p
  3. Bos taurus bta-miR-26a
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-26a
  5. Callorhinchus milii Cmi-Mir-26-P1_5p (mature (guide))
  6. Canis lupus familiaris (dog) cfa-miR-26a
  7. Capra hircus (goat) chi-miR-26a-5p
  8. Cavia porcellus (domestic guinea pig) cpo-miR-26a-5p
  9. Cervus elaphus cel-miR-26a
  10. Chiloscyllium plagiosum microRNA cpl-miR-26
  11. Chrysemys picta bellii Cpi-Mir-26-P1_5p (mature (guide))
  12. Chrysemys picta (Painted turtle) cpi-miR-26-5p
  13. Columba livia (rock pigeon) cli-miR-26-5p
  14. Cyprinus carpio (common carp) ccr-miR-26a
  15. Danio rerio (zebrafish) dre-miR-26a-5p
  16. Dasypus novemcinctus dno-miR-26a-5p
  17. Daubentonia madagascariensis (aye-aye) dma-miR-26a
  18. Echinops telfairi Ete-Mir-26-P1_5p (mature (guide))
  19. Eptatretus burgeri (inshore hagfish) Ebu-Mir-26-P5_5p (mature (guide))
  20. Equus caballus eca-miR-26a
  21. Gadus morhua gmo-miR-26a-5p
  22. Gallus gallus (chicken) gga-miR-26a-2-5p
  23. Gekko japonicus Gja-Mir-26-P1_5p (mature (guide))
  24. Gorilla gorilla gorilla ggo-miR-26a (MIR26A)
  25. Gorilla gorilla (western gorilla) ggo-miR-26a
  26. Haplochromis burtoni abu-miR-26a
  27. Homo sapiens hsa-miR-26a-5p
  28. Ictalurus punctatus (channel catfish) ipu-miR-26a
  29. Lagothrix lagotricha (brown woolly monkey) lla-miR-26a
  30. Latimeria chalumnae Lch-Mir-26-P4_5p (mature (guide))
  31. Lepisosteus oculatus (spotted gar) Loc-Mir-26-P1_5p (mature (guide))
  32. Macaca mulatta (Rhesus monkey) mml-miR-26a-5p
  33. Macaca nemestrina mne-miR-26a
  34. Maylandia zebra (zebra mbuna) mze-miR-26a
  35. Microcaecilia unicolor Mun-Mir-26-P4_5p (mature (guide))
  36. Microcebus murinus (gray mouse lemur) mmr-miR-26a
  37. Monodelphis domestica Mdo-Mir-26-P1_5p (mature (guide))
  38. Monopterus albus Mal-Mir-26-P1b_5p (mature (guide))
  39. Mus musculus mmu-miR-26a-5p
  40. Neolamprologus brichardi (lyretail cichlid) nbr-miR-26a
  41. Nomascus leucogenys nle-miR-26a
  42. Ophiophagus hannah oha-miR-26-5p
  43. Oreochromis niloticus (Nile tilapia) oni-miR-26a
  44. Ornithorhynchus anatinus (platypus) oan-miR-26-5p
  45. Oryctolagus cuniculus (rabbit) ocu-miR-26a-5p
  46. Otolemur garnettii (small-eared galago) oga-miR-26a
  47. Ovis aries (sheep) oar-miR-26a
  48. Pan paniscus ppa-miR-26a
  49. Pan troglodytes ptr-miR-26a
  50. Papio hamadryas pha-miR-26a
  51. Petromyzon marinus pma-miR-26a-5p
  52. Pongo pygmaeus (Bornean orangutan) ppy-miR-26a
  53. Pteropus alecto (black flying fox) pal-miR-26a-5p
  54. Pundamilia nyererei pny-miR-26a
  55. Python bivittatus (Burmese python) pbv-miR-26-5p
  56. Rattus norvegicus rno-miR-26a-5p
  57. Saimiri boliviensis boliviensis sbo-miR-26a
  58. Salmo salar ssa-miR-26a-5p
  59. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-26-P1_5p (mature (guide))
  60. Scyliorhinus torazame (cloudy catshark) Sto-Mir-26-P1_5p (mature (guide))
  61. Sphenodon punctatus (tuatara) Spt-Mir-26-P1_5p (mature (guide))
  62. Taeniopygia guttata (zebra finch) tgu-miR-26-5p
  63. Takifugu rubripes fru-miR-26
  64. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-26
  65. Tor tambroides miR-26a-5p
  66. Tupaia chinensis (Chinese tree shrew) tch-miR-26a-5p
  67. Xenopus laevis xla-miR-26-5p
  68. Xenopus tropicalis Xtr-Mir-26-P1_5p (mature (guide))
Publications