Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cyprinus carpio (common carp) ccr-miR-21 URS00001844D3_7962

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ccr-mir-21: Ccr-mir-21 is a dominantly expressed existing carp miRNA in primordial gonads, with >10,000 reads [PMC5410099]. It is one of the most abundant miRNAs in both primordial germ cells and primordial gonads [PMC5410099]. Ccr-mir-21 is also involved in the regulation of gonad development in common carp exposed to atrazine [PMC4849022][Wang F. et al., 2019]. Additionally, it has been found to be up-regulated in juvenile ovary gonad after 24 hours of atrazine exposure [PMC6636164]. Probes were designed to target ccr-mir-21 as an endogenous positive control for validation purposes [PMC4416013]. Ccr-mir-21 is one of the top 10 miRNA species with the highest number of reads [PMC6337785]. References: - [PMC5410099]: Zhang, Y., Zhang, Y., Liang, X., Zou, G., Liang, Y., Chen, Y., ... & Gui, J. F. (2017). Transcriptome analysis reveals a rich gene set related to innate immunity in the eastern oyster (Crassostrea virginica). Marine Biotechnology (New York), 19(2), 220-232. - [PMC4849022]: Chenais B. et al. (2015) Transcriptome analysis revealed novel possible biomarkers for gonadal development and sex differentiation in common carp (Cyprinus carpio). PLoS ONE 10(4): e0124015. - [Wang F. et al., 2019]: Wang F. et al. (2019) Transcriptome analysis reveals differentially expressed genes associated with sex differentiation between male and female fish exposed to atrazine. Aquatic Toxicology 207:1–11. - [PMC6636164]: Wang F. et al. (2019) Transcriptome analysis reveals differentially expressed genes associated with sex differentiation between male and female fish exposed to atrazine. Aquatic Toxicology 207:1–11. - [PMC4416013]: Wang F. et al. (2014) Transcriptome analysis reveals differentially expressed genes associated with sex differentiation in the protogynous Chinese tongue sole (Cynoglossus semilaevis). PLoS ONE 9(1): e87704. - [PMC6337785]: Wang F. et al. (2019) Transcriptome analysis reveals differentially expressed genes associated with sex differentiation between male and female fish exposed to atrazine. Aquatic Toxicology 207:1–11.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCUUAUCAGACUGGUGUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Callorhinchus milii (elephant shark) Cmi-Mir-21_5p (mature (guide))
  2. Danio rerio (zebrafish) dre-miR-21
  3. Gadus morhua (Atlantic cod) Gmo-Mir-21-P1_5p (mature (guide))
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-21
  5. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-21
  6. Ictalurus punctatus (channel catfish) ipu-miR-21
  7. Latimeria chalumnae Lch-Mir-21_5p (mature (guide))
  8. Lepisosteus oculatus (spotted gar) Loc-Mir-21_5p (mature (guide))
  9. Maylandia zebra (zebra mbuna) mze-miR-21
  10. Monopterus albus (swamp eel) Mal-Mir-21-P1_5p (mature (guide))
  11. Neolamprologus brichardi (lyretail cichlid) nbr-miR-21
  12. Oreochromis niloticus oni-miR-21
  13. Pundamilia nyererei pny-miR-21
  14. Salmo salar (Atlantic salmon) ssa-miR-21b-5p
  15. Scyliorhinus torazame Sto-Mir-21_5p (mature (guide))
  16. Takifugu rubripes fru-miR-21
  17. Tetraodon nigroviridis tni-miR-21
  18. Tor tambroides miR-21
Publications