Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-21 URS00001844D3_7955

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dre-miR-21: Dre-mir-21 is a type of miRNA that has been studied in various contexts. LNA in situ hybridization was used to detect dre-mir-21 expression in kidney cryosections [PMC4650918]. Dre-mir-21 was found to be highly expressed in muscle miRNAs, accounting for 21% of the total [PMC2684549]. In a study using zebrafish larvae, dre-mir-21 was one of the upregulated miRNAs after TnP treatment [PMC8268205]. The mature sequence region of dre-mir-30e-2 was replaced with the mature sequence of dre-mir-21 in a specific vector [PMC8583575]. In another study, the expression levels of dre-mir-21 were found to be elevated in the liver of zebrafish injected with MCs [PMC5308255]. Dre-mir-21, along with other highly expressed miRNAs like dre-miR-143, played a role in regulating fish activities under hypoxia stress [PMC8696637]. Dre-mir-21 is part of the miR-21 family, which includes homologous miRNAs from different species such as Gallus gallus and Homo sapiens [PMC3923817]. References: [PMC4650918] - LNA in situ hybridization on kidney cryosections [PMC2684549] - High expression levels of let-7 family and dre-miR-21 [PMC8268205] - Upregulation of dre-miR after TnP treatment [PMC8583575] - Replacement and subcloning using dre-miR sequences [PMC5308255] - Elevated expression levels in zebrafish liver injected with MCs [PMC8696637] - Role under hypoxia stress [PMC3923817] - miR-21 family members from different species

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCUUAUCAGACUGGUGUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Callorhinchus milii (elephant shark) Cmi-Mir-21_5p (mature (guide))
  2. Cyprinus carpio (common carp) ccr-miR-21
  3. Gadus morhua (Atlantic cod) Gmo-Mir-21-P1_5p (mature (guide))
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-21
  5. Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-21
  6. Ictalurus punctatus (channel catfish) ipu-miR-21
  7. Latimeria chalumnae Lch-Mir-21_5p (mature (guide))
  8. Lepisosteus oculatus (spotted gar) Loc-Mir-21_5p (mature (guide))
  9. Maylandia zebra (zebra mbuna) mze-miR-21
  10. Monopterus albus (swamp eel) Mal-Mir-21-P1_5p (mature (guide))
  11. Neolamprologus brichardi (lyretail cichlid) nbr-miR-21
  12. Oreochromis niloticus oni-miR-21
  13. Pundamilia nyererei pny-miR-21
  14. Salmo salar (Atlantic salmon) ssa-miR-21b-5p
  15. Scyliorhinus torazame Sto-Mir-21_5p (mature (guide))
  16. Takifugu rubripes fru-miR-21
  17. Tetraodon nigroviridis tni-miR-21
  18. Tor tambroides miR-21
Publications