Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cervus elaphus (red deer) cel-miR-34a URS00001646B5_9860

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUCUUAGCUGGUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-34a-5p
  2. Anolis carolinensis (green anole) Aca-Mir-34-P1_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-34-P1_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-34a
  5. Callorhinchus milii Cmi-Mir-34-P1_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-34-P1_5p (mature (guide))
  7. Cavia porcellus Cpo-Mir-34-P1_5p (mature (guide))
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-34-P1_5p (mature (guide))
  9. Columba livia Cli-Mir-34-P1_5p (mature (guide))
  10. Danio rerio (zebrafish) Dre-Mir-34-P1_5p (mature (guide))
  11. Echinops telfairi Ete-Mir-34-P1_5p (mature (guide))
  12. Gallus gallus (chicken) gga-miR-34a-5p
  13. Gekko japonicus Gja-Mir-34-P1_5p (mature (guide))
  14. Homo sapiens Hsa-Mir-34-P1_5p (mature (guide))
  15. Latimeria chalumnae Lch-Mir-34-P1_5p (mature (guide))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-34-P1_5p (mature (guide))
  17. Macaca mulatta (Rhesus monkey) Mml-Mir-34-P1_5p (mature (guide))
  18. Microcaecilia unicolor Mun-Mir-34-P1_5p (mature (guide))
  19. Monodelphis domestica mdo-miR-34a-5p
  20. Monopterus albus Mal-Mir-34-P1_5p (mature (guide))
  21. Mus musculus Mmu-Mir-34-P1_5p (mature (guide))
  22. Ophiophagus hannah oha-miR-34a-5p
  23. Ornithorhynchus anatinus (platypus) Oan-Mir-34-P1_5p (mature (guide))
  24. Oryctolagus cuniculus (rabbit) Ocu-Mir-34-P1_5p (mature (guide))
  25. Petromyzon marinus Pma-Mir-34-P1_5p (mature (guide))
  26. Python bivittatus Pbv-Mir-34-P1_5p (mature (guide))
  27. Rattus norvegicus Rno-Mir-34-P1_5p (mature (guide))
  28. Sarcophilus harrisii Sha-Mir-34-P1_5p (mature (guide))
  29. Scyliorhinus torazame (cloudy catshark) Sto-Mir-34-P1_5p (mature (guide))
  30. Sphenodon punctatus (tuatara) Spt-Mir-34-P1_5p (mature (guide))
  31. Taeniopygia guttata (zebra finch) Tgu-Mir-34-P1_5p (mature (guide))
  32. Tupaia chinensis tch-miR-34a-5p
  33. Xenopus laevis (African clawed frog) Xla-Mir-34-P1b_5p (mature (guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-34a