v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-34a-5p URS00001646B5_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-34a: Gga-mir-34a is a type of microRNA that has been identified in several studies to be related to muscle function, muscle cell differentiation, energy metabolism, and immune response [PMC7326969] [PMC4735322] [PMC5203650] [PMC8531282]. It has been found to be involved in the regulation of various target genes, including CLEC3B, GGTLA1, WNK1, cathepsin G (CTSG), KDM6A, TMEFF2, CDC20, NTRK2, SHISA2, and NOX4 [PMC5203650]. Gga-mir-34a is also highly conserved among different species and has similar functions to gga-miR-449c [PMC7699918]. Overexpression of gga-mir-34a and gga-miR-449c has been shown to significantly decrease the expression levels of IL-2 and IL-12α but not IL-4 [PMC7699918]. In chicken hepatocytes, gga-mir-34a has been found to increase intracellular levels of triglycerides and cholesterol by targeting ACSL1 [PMC7936154]. Additionally, gga-mir-34a has been identified as a microRNA that targets several immune-related genes in infected chicken lungs [PMC3496578]. Overall, gga-mir-34a plays a crucial role in various biological processes and may have potential implications in muscle function regulation as well as immune response modulation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGCAGUGUCUUAGCUGGUUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Alligator mississippiensis (American alligator) ami-miR-34a-5p
  2. Anolis carolinensis (green anole) Aca-Mir-34-P1_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-34-P1_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-34a
  5. Callorhinchus milii Cmi-Mir-34-P1_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-34-P1_5p (mature (guide))
  7. Cavia porcellus Cpo-Mir-34-P1_5p (mature (guide))
  8. Cervus elaphus (red deer) cel-miR-34a
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-34-P1_5p (mature (guide))
  10. Columba livia Cli-Mir-34-P1_5p (mature (guide))
  11. Danio rerio (zebrafish) Dre-Mir-34-P1_5p (mature (guide))
  12. Echinops telfairi Ete-Mir-34-P1_5p (mature (guide))
  13. Gekko japonicus Gja-Mir-34-P1_5p (mature (guide))
  14. Homo sapiens Hsa-Mir-34-P1_5p (mature (guide))
  15. Latimeria chalumnae Lch-Mir-34-P1_5p (mature (guide))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-34-P1_5p (mature (guide))
  17. Macaca mulatta (Rhesus monkey) Mml-Mir-34-P1_5p (mature (guide))
  18. Microcaecilia unicolor Mun-Mir-34-P1_5p (mature (guide))
  19. Monodelphis domestica mdo-miR-34a-5p
  20. Monopterus albus Mal-Mir-34-P1_5p (mature (guide))
  21. Mus musculus Mmu-Mir-34-P1_5p (mature (guide))
  22. Ophiophagus hannah oha-miR-34a-5p
  23. Ornithorhynchus anatinus (platypus) Oan-Mir-34-P1_5p (mature (guide))
  24. Oryctolagus cuniculus (rabbit) Ocu-Mir-34-P1_5p (mature (guide))
  25. Petromyzon marinus Pma-Mir-34-P1_5p (mature (guide))
  26. Python bivittatus Pbv-Mir-34-P1_5p (mature (guide))
  27. Rattus norvegicus Rno-Mir-34-P1_5p (mature (guide))
  28. Sarcophilus harrisii Sha-Mir-34-P1_5p (mature (guide))
  29. Scyliorhinus torazame (cloudy catshark) Sto-Mir-34-P1_5p (mature (guide))
  30. Sphenodon punctatus (tuatara) Spt-Mir-34-P1_5p (mature (guide))
  31. Taeniopygia guttata (zebra finch) Tgu-Mir-34-P1_5p (mature (guide))
  32. Tupaia chinensis tch-miR-34a-5p
  33. Xenopus laevis (African clawed frog) Xla-Mir-34-P1b_5p (mature (guide))
  34. Xenopus tropicalis (tropical clawed frog) xtr-miR-34a
 Publications