Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-487b URS000015B295_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-487b: Cfa-mir-487b is a microRNA that has been studied in the context of canine mitral valve disease (MMVD). In several studies, it has been found that cfa-mir-487b is downregulated in dogs with MMVD, specifically in stages B1/B2 or C/D, compared to stage A dogs [PMC9607079] [PMC4490541] [PMC5533140]. Additionally, when comparing stages B1/B2 and C/D, the expression of cfa-mir-487b was found to be higher in the later stages [PMC9607079]. In dogs with MMVD and mild to moderate cardiac enlargement or congestive heart failure, cfa-mir-487b was also downregulated compared to normal dogs [PMC4964495]. Furthermore, the expression of cfa-mir-487b significantly differed between dogs with congestive heart failure and those with mild to moderate cardiac enlargement [PMC4964495]. Overall, these findings suggest that cfa-mir-487b may play a role in the progression and severity of MMVD. However, further research is needed to fully understand its specific functions and mechanisms in this disease.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUCGUACAGGGUCAUCCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-487b
  2. Callithrix jacchus cja-miR-487b
  3. Capra hircus (goat) chi-miR-487b-3p
  4. Cavia porcellus (domestic guinea pig) cpo-miR-487b-3p
  5. Cervus elaphus (red deer) cel-miR-487b
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487b-3p
  7. Echinops telfairi Ete-Mir-154-P17_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-487b
  9. Homo sapiens hsa-miR-487b-3p
  10. Macaca mulatta mml-miR-487b-3p
  11. Mus musculus (house mouse) mmu-miR-487b-3p
  12. Oryctolagus cuniculus ocu-miR-487b-3p
  13. Ovis aries (sheep) oar-miR-487b-3p
  14. Pan troglodytes (chimpanzee) ptr-miR-487b
  15. Pongo pygmaeus ppy-miR-487b
  16. Pteropus alecto pal-miR-487b-3p
  17. Rattus norvegicus (Norway rat) rno-miR-487b-3p
Publications