Mus musculus (house mouse) mmu-miR-487b-3p URS000015B295_10090

• 22 nucleotides
• 5 databases (ENA, miRBase, MirGeneDB, PirBase, RefSeq)
• Found in 17 other species
• 371 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. piRNA

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AAUCGUACAGGGUCAUCCACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

1. Bos taurus (cattle) bta-miR-487b
2. Callithrix jacchus cja-miR-487b
3. Canis lupus familiaris cfa-miR-487b
4. Capra hircus (goat) chi-miR-487b-3p
5. Cavia porcellus (domestic guinea pig) cpo-miR-487b-3p
6. Cervus elaphus (red deer) cel-miR-487b
7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-487b-3p
8. Echinops telfairi Ete-Mir-154-P17_3p (mature (guide))
9. Equus caballus (horse) eca-miR-487b
10. Homo sapiens hsa-miR-487b-3p
11. Macaca mulatta mml-miR-487b-3p
12. Oryctolagus cuniculus ocu-miR-487b-3p
13. Ovis aries (sheep) oar-miR-487b-3p
14. Pan troglodytes (chimpanzee) ptr-miR-487b
15. Pongo pygmaeus ppy-miR-487b
16. Pteropus alecto pal-miR-487b-3p
17. Rattus norvegicus (Norway rat) rno-miR-487b-3p

Publications Download

• FASTA
• JSON