Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saimiri boliviensis boliviensis (Bolivian squirrel monkey) sbo-miR-424 URS00000F0F49_39432

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAGCAAUUCAUGUUUUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-15-P1c_5p (mature (guide))
  2. Canis lupus familiaris (dog) Cfa-Mir-15-P1c_5p (mature (guide))
  3. Cavia porcellus cpo-miR-424-5p
  4. Dasypus novemcinctus dno-miR-424-5p
  5. Eptesicus fuscus efu-miR-424
  6. Equus caballus (horse) eca-miR-424
  7. Homo sapiens (human) hsa-miR-424-5p
  8. Macaca mulatta mml-miR-424-5p
  9. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49665523
  10. Nomascus leucogenys nle-miR-424
  11. Oryctolagus cuniculus (rabbit) ocu-miR-424-5p
  12. Pan paniscus ppa-miR-424
  13. Pan troglodytes (chimpanzee) ptr-miR-424
  14. Pongo pygmaeus ppy-miR-424
  15. Sus scrofa (pig) ssc-miR-424-5p