Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-424-5p URS00000F0F49_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGCAGCAAUUCAUGUUUUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus Bta-Mir-15-P1c_5p (mature (guide))
  2. Canis lupus familiaris (dog) Cfa-Mir-15-P1c_5p (mature (guide))
  3. Dasypus novemcinctus dno-miR-424-5p
  4. Eptesicus fuscus efu-miR-424
  5. Equus caballus (horse) eca-miR-424
  6. Homo sapiens (human) hsa-miR-424-5p
  7. Macaca mulatta mml-miR-424-5p
  8. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-49665523
  9. Nomascus leucogenys nle-miR-424
  10. Oryctolagus cuniculus (rabbit) ocu-miR-424-5p
  11. Pan paniscus ppa-miR-424
  12. Pan troglodytes (chimpanzee) ptr-miR-424
  13. Pongo pygmaeus ppy-miR-424
  14. Saimiri boliviensis boliviensis sbo-miR-424
  15. Sus scrofa (pig) ssc-miR-424-5p
Publications