Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, C/D box 8 (ENSG00000200785.1) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, C/D box 8 (ENSG00000200785.1) URS00000E9A93_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD8: SNORD8 is a small nucleolar RNA (snoRNA) that has been used as an endogenous control in various studies [PMC5893808]. It has been found to be upregulated in proliferating normal B-cells and proliferating chronic lymphocytic leukemia (CLL) cells, suggesting its functional relevance in cell proliferation [PMC9219770]. SNORD8 has also been identified as part of gene clusters involved in RNA processing and aging [PMC8845137]. Additionally, SNORD8 expression has been validated using quantitative reverse transcription PCR (qRT-PCR) in different samples, such as TC2 group and sPCL samples [PMC3511933]. Reduction of SNORD8 levels using antisense oligonucleotides (ASOs) has been shown to affect the 2'-O-methylation (2'-OMe) modification at specific positions within the U6 small nuclear RNA (snRNA), without affecting its abundance or processing [PMC9136273]. Furthermore, SNORD8 has been included in risk models for different cohorts and identified as part of signatures specific to certain subgroups of multiple myeloma patients [PMC9939161] [PMC8629011]. Overall, these studies highlight the importance of SNORD8 in various biological processes and its potential as a biomarker or therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAAUGAUGAGUUGCCAUGCUAAUACUGAGCCACCAGGUAGGGCAGUGUUGCCCUGGUUUGGGUGCCAGUGAGUUUAACAAAACUUCUCACAUGAAGAUCUGAGGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

2D structure Publications