v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Theropithecus gelada (gelada) small nucleolar RNA U6-53/MBII-28 (ENSTGEG00000016417.1) secondary structure diagram

Theropithecus gelada (gelada) small nucleolar RNA U6-53/MBII-28 (ENSTGEG00000016417.1) URS00000E9A93_9565

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCAAUGAUGAGUUGCCAUGCUAAUACUGAGCCACCAGGUAGGGCAGUGUUGCCCUGGUUUGGGUGCCAGUGAGUUUAACAAAACUUCUCACAUGAAGAUCUGAGGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Cercocebus atys (Sooty mangabey) small nucleolar RNA, C/D box 8 (ENSCATG00000018895.1)
  2. Chlorocebus sabaeus (African green monkey) small nucleolar RNA, C/D box 8 (ENSCSAG00000027674.1)
  3. Homo sapiens small nucleolar RNA, C/D box 8 (ENSG00000200785.1)
  4. Macaca fascicularis snoRNA (ENSMFAG00000053947.1, ENSMFAG00000060524.1)
  5. Macaca mulatta small nucleolar RNA, C/D box 8 (ENSMMUG00000024873.3)
  6. Macaca nemestrina small nucleolar RNA, C/D box 8 (ENSMNEG00000001029.1)
  7. Mandrillus leucophaeus small nucleolar RNA, C/D box 8 (ENSMLEG00000011555.1)
  8. Pan troglodytes small nucleolar RNA, C/D box 8 (ENSPTRG00000026581.2)
  9. Papio anubis small nucleolar RNA, C/D box 8 (ENSPANG00000033811.2)
  10. Piliocolobus tephrosceles snoRNA (ENSPTEG00000023412.1)
  11. Rhinopithecus bieti small nucleolar RNA, C/D box 8 (ENSRBIG00000020033.1)
  12. Rhinopithecus roxellana small nucleolar RNA, C/D box 8 (ENSRROG00000003837.1)
 2D structure