Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-1343 URS00000DA3DF_9925

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

chi-mir-1343: Chi-mir-1343 is a microRNA that has been predicted to bind to 88 mRNAs in the 30 vs. 18 M comparison and 83 mRNAs in the 18 vs. 6 M comparison, indicating its multifaceted regulatory role [PMC9672515]. Among the differentially expressed microRNAs (DE miRNA), chi-mir-1343 is found to target the most mRNAs (118), followed by oar-miR-370-3p_R-2, bta-miR-2387_R+1, and oan-miR-103-3p_R+2 [PMC9672515]. Furthermore, chi-mir-1343 has been observed to bind to multiple mRNAs in different groups [PMC9672515]. This suggests that chi-mir-1343 may have a crucial regulatory role in sheep tail fat growth and development, although its mechanism in metabolic regulation requires further investigation [PMC9672515]. In addition to its role in mRNA regulation, chi-mir-1343 is also involved in circRNA–miRNA networks. In the HF vs. LF comparison, chi_circ_0030920 targeted by chi-miR-129-3p and chi_circ_0043017 targeted by chi-miR324–3p were identified [PMC8820483]. In the HL vs. LL comparison, circRNAs targeted by different miRNAs were identified: chi_circ_0008353 targeted by chi-miR15a–3p, chi_circ_0041580 targeted by chimiR188–3p, and chici_rc_0016478 targeted by chimi_r134–1 [PMC8820483]. Furthermore, target gene regulatory networks have shown that chi_mir_134 targets a total of 284 mRNAs, which is the highest among the differentially expressed microRNAs [PMC8470123]. These findings highlight the importance of chi-mir-1343 in regulating gene expression and suggest its potential role in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCCUGGGGCCCGCACUCUCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications