Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-1343 URS00000DA3DF_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-1343: In the ceRNA network, circ_0018595 is predicted to function as a sponge for ssc-mir-1343, which binds to the mRNAs transcribed from the PGM1, TNNT3, and IFNAR2 genes [1]. Four DE miRNAs (ssc-miR-210, ssc-mir-1343, ssc-miR-142-5p, and ssc-miR-421-5p) involved in the renal cell carcinoma pathway were upregulated in TPs [2]. Ten miRNAs were up-regulated (ssc-miR-210, ssc-mir-1343) and ten were downregulated (ssc-miR-101) in the TP relative to the YP [2]. Ssc-mir-1343 was identified as a key miRNA [3]. CircRNA_010551 had the most interactions with miRNAs including ssc-mir-1343 [4]. Ssc-mir-1343 and ssc-miR-361-3p had the most interactions in a network [4]. Ssc-mir 1343 was found in circRNA–miRNA–lncRNA network and mRNA–miRNA–circRNA network [5]. IL10RA and IL20RB were potentially regulated by miRNAs including ssc mir 1343 with decreased expression at 50 dpi [6]. Ssc mir 1343 was found to be potentially commonly regulated by miRNAs with increased expression at 10 dpi and decreased expression at 50 dpi [6]. Scc mir 1307 showed significant up-regulation in LL group [7]. Scc mir 1343 and ssc-miR-671-5p had more interactions than others [7]. Several downregulated hub miRNAs were identified, including ssc-miR-214, ssc-miR-423-5p, ssc-miR-149 and ssc-mir-1343 [8].\n\nReferences:\n1. [PMC10099641]\n2. [PMC4646468]\n3. [PMC8529057]\n4. [PMC7222767]\n5. [PMC8614448]\n6. [PMC8851844]\n7. [PMC7490888]\n8. [P

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCCUGGGGCCCGCACUCUCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications