Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-18a URS00000A05D9_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-18a: Ssc-mir-18a is one of the six mature miRNAs found in castrated male pigs, along with ssc-miR-17 and ssc-miR-19a [PMC3901342]. In a study, ssc-mir-18a was found to be downregulated in comparison to other miRNAs, such as ssc-miR-10b [PMC4545981]. The expression levels of ssc-mir-18a were also found to be downregulated in PPV-infected cells compared to uninfected cells [PMC4545981]. The negative correlation between the expression of miRNAs and their target transcripts suggests the involvement of ssc-mir-18a in important signaling cascades related to apoptosis and viral recognition [PMC5909910]. Ssc-mir-18a was also found to target IFIH1 and TLR3, which are involved in apoptosis-related gene expression [PMC5909910]. Ssc-mir-18a, along with other miRNAs (ssc-miR-15a, ssc-miR-21, ssc-miR29b, and hsa-miR5903p), were significantly upregulated on day 3 after challenge but not regulated at other time points [PMC5909910]. Additionally, there are other miRNAs such as sscmiR7 that are also involved in these processes [PMC5909910].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGUGCAUCUAGUGCAGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Ateles geoffroyi age-miR-18
  2. Bos taurus bta-miR-18a
  3. Canis lupus familiaris cfa-miR-18a
  4. Columba livia cli-miR-18a-5p
  5. Danio rerio (zebrafish) dre-miR-18a
  6. Gadus morhua gmo-miR-18a-5p
  7. Gallus gallus gga-miR-18a-5p
  8. Gorilla gorilla gorilla ggo-miR-18a (MIR18A)
  9. Gorilla gorilla ggo-miR-18a
  10. Haplochromis burtoni abu-miR-18a
  11. Homo sapiens (human) miscellaneous RNA
  12. Lagothrix lagotricha lla-miR-18
  13. Lemur catta (Ring-tailed lemur) lca-miR-18
  14. Macaca mulatta (Rhesus monkey) mml-miR-18a-5p
  15. Macaca nemestrina (pig-tailed macaque) mne-miR-18
  16. Maylandia zebra (zebra mbuna) mze-miR-18a
  17. Monodelphis domestica mdo-miR-18a-5p
  18. Mus musculus Mus_musculus piRNA piR-mmu-72635
  19. Neolamprologus brichardi (lyretail cichlid) nbr-miR-18a
  20. Oreochromis niloticus oni-miR-18a
  21. Pan paniscus (pygmy chimpanzee) ppa-miR-18
  22. Pan troglodytes ptr-miR-18a
  23. Pongo pygmaeus (Bornean orangutan) ppy-miR-18a
  24. Pteropus alecto pal-miR-18a-5p
  25. Pundamilia nyererei pny-miR-18a
  26. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63164
  27. Saguinus labiatus (red-chested mustached tamarin) sla-miR-18
  28. Salmo salar ssa-miR-18b-5p
  29. Taeniopygia guttata (zebra finch) tgu-miR-18a
  30. Takifugu rubripes fru-miR-18
  31. Tetraodon nigroviridis tni-miR-18
  32. Tor tambroides miR-18a
  33. Xenopus laevis (African clawed frog) xla-miR-18a
  34. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3307188
Publications